identification of intrinsically disordered proteins by a special 2d electrophoresis
Báo cáo y học: "Insights into the regulation of intrinsically disordered proteins in the human proteome by analyzing sequence and gene expression data" potx
... Decay rates of human mRNAs: correlation with functional characteristics and sequence attributes Genome Res 2003, 13:1863-1872 Raghavan A, Bohjanen PR: Microarray-based analyses of mRNA decay ... YKE carried out the miRNA and ubiquitin target analysis and drafted the major part of the manuscript AEL carried out the microarray analysis, ubiquitin predictions and function analysis and assisted ... disordered proteins (Figures 1d and 2d; Figure S1c in Additional data file 1) Additionally, the method and the materials of Chen et al [83] provide an estimate of miRNA targeting higher than our analysis...
- 18
- 326
- 0
IDENTIFICATION OF INTRINSICALLY DISORDERED SEPTAL PORE ASSOCIATED PROTEINS REGULATING DIVERSE ASPECTS OF
... Allen, 1978b), algae and terrestrial plants (Allen and Allen, 197 8a) , and animals (Niwayama et al., 2011) In plants and animals, cytoplasmic streaming is generated by actin and myosin and plays ... 850 and 900 Da (Lucas and Wolf, 1993) and can be regulated to allow the passage of molecules as large as 20 kDa such as proteins and nucleic acids The regulation of plasmodesmata SEL is important ... and Balasubramaniam lab for useful discussion and general camaraderie and also for being a reliable source of rare reagents Life at the institute would not be the same without the interaction and...
- 0
- 115
- 0
Báo cáo khoa học: Phosphorylation of NF-jB proteins by cyclic GMP-dependent kinase A noncanonical pathway to NF-jB activation potx
... from the NIH AIDS Reagent Repository) was Flag-tagged at the 5¢-end by PCR using the primers 5¢-CTGCAGCATGGACTACAAGGACGACGA TGACAAGGAGAGTTGCTACAACCCAGGTCTG-3¢ and 5¢-GAGAGTTGCTACAACCCAGGTCTG-3¢ ... 5¢-GCGGCGGCCTGCCGACCGG GAGCTCAGT-3¢ for S27 6A and 5¢-AAACGTAAAAG GGCATATGAGACCTTCAAGAGCATC-3¢ for T30 5A (mutations in bold) The accuracy of the mutations was confirmed by DNA sequencing p49 (obtained from ... (Promega, sense 5¢-TGTCG AATGCAAATCACTAGAA-3¢), H2K (sense 5¢-GGATC CCGGTCGGGGGATTCCCCATCTCGG-3¢), j enhancer (sense 5¢-AGCAGAGGGGACTTTCCGAGGC-3¢) The custom made oligonucleotides were obtained as...
- 12
- 341
- 0
Báo cáo y học: " Increased production of viral proteins by a 3''''-LTR-deleted infectious clone of human T-cell leukemia virus type 1" ppsx
... Hinuma Y, Nagata K, Hanaoka M, Nakai M, Matsumoto T, Kinoshita KI, Shirakawa S, Miyoshi I: Adult T-cell leukemia: antigen in an ATL cell line and detection of antibodies to the antigen in human ... I Tax oncoprotein: cellular signaling through NFkappa B Cytokine Growth Factor Rev 2001, 12:207-217 Sun SC, Yamaoka S: Activation of NF-kappaB by HTLV-I and implications for cell transformation ... structure localization signal are required for Tax nuclear localization J Virol 2009, 83:5339-5352 23 24 25 26 27 Hirata A, Higuchi M, Niinuma A, Ohashi M, Fukushi M, Oie M, Akiyama T, Tanaka Y, Gejyo...
- 5
- 260
- 0
Báo cáo y học: "Identification of Cellular Membrane Proteins Interacting with Hepatitis B Surface Antigen using Yeast Split-Ubiquitin System"
... Malayaman N, Hu Z, Liang TJ Decay accelerating factor Regulation of [16, 17] Structural and functional characterization of interaction between for complement (DAF) complement activation hepatitis ... selected randomly for PCR amplification Size of individual inserts reflected by the size of the amplified PCR product was analysed on an agarose gel Lane to 22, PCR product from each of the 22 randomly ... Nanyang Technological University, Singapore QC Toh and WQ Teo are from Ngee Ann Polytechnic, Singapore CY Ho and S Parida are undergraduate students from School of Biological Sciences, Nanyang...
- 4
- 493
- 0
Tài liệu Báo cáo khoa học: Analysis of the molecular dynamics of medaka nuage proteins by fluorescence correlation spectroscopy and fluorescence recovery after photobleaching doc
... 5Â-GGAGATCTAAAATGGACGACTGGGAGGAAGA-3Â and 5Â-GCGAATTCGTTGAAAACTTTTAATTATCA GGAGAAAAC-3Â, 5Â-CGAGATCTAGCATGTCAGACG TGGAGTCTGGA-3Â and 5Â-GCGAATTCGCAACCAAA GACAACCTGGTTTTAATGTTTTGA-3Â, and 5Â-CGAG ATCTGAAATGAACGAGCTGCGTATGCCGAA-3Â ... 5Â-GCGCTAGCTAAT ACGACTCACTATAGGGAGATCTAAAATGGACGAC TGGGAGGAAGA-3Â and 5Â-GCGAATTCGTTGAAA ACTTTTAATTATCAGGAGAAAAC-3Â This PCR fragment has a T7 promoter for RNA synthesis Capped RNA was synthesized by ... ATCTGAAATGAACGAGCTGCGTATGCCGAA-3Â and 5Â-GCGAATTCAACACAAGAGTTGTTTTATATTGAA CCCA-3Â, respectively The PCR product was digested and ligated into the multiple cloning site of pEGFP-Cl (Clontech, Palo...
- 9
- 655
- 0
Tài liệu Báo cáo khoa học: Selection of stably folded proteins by phage-display with proteolysis docx
... protein by phage display coupled with proteolysis and structural characterization by NMR and X-ray crystallography J Mol Biol 323, 253–262 19 Regan, L & DeGrado, W.F (1988) Characterization of a helical ... genes For small protein domains, they may have evolved by assembly and/or exchange of small gene segments, leading to diversification of the domain architecture and even generation of an entirely ... absence of any cofactors In this work, the authors used the method similar to that of Finucane et al [11] except that the protein A B-domain instead of His-tag was used to select the folded proteins...
- 6
- 444
- 0
Tài liệu Báo cáo khoa học: "Detection of Japanese Homophone Errors by a Decision List Including a Written Word as a Default Evidence" docx
... Proceedings of EACL '99 Masahiro Oku and Koji Matsuoka 1997 A Method for Detecting Japanese Homophone Errors in Compound Nouns based on Character Cooccurrence and Its Evaluation (in Japanese) Journal of ... Koji Tochinai, Taisuke Itoh, and Yasuhiro Suzuki 1986 Kana-Kanji Translation System with Automatic Homonym Selection Using Character Chain Matching (in Japanese) Journal of Information Processing, ... est(wh,ej) among 5As in this paper, the addition of a small value is an easy and effective way to avoid the unsatisfactory case, as shown in (Yarowsky, 1994) 182 760 ~.~ ¢ ) + (of+ ) , 0.358...
- 8
- 588
- 0
Báo cáo khoa học: Induction of raft-like domains by a myristoylated NAP-22 peptide and its Tyr mutant potx
... membrane targeting of myristoylated and palmitoylated proteins Biochim Biophys Acta 1451, 1–16 Gratzer WB (1970) Numerical values of the absorbances of the aromatic amino acids In Handbook of Biochemistry: ... related proteins, function to enhance the accumulation and assembly of PtdIns(4, 5)P2-rich raft domains [36] During neuronal development, axonal elongation and branching are regulated by the activity ... growth and development CAP-23 accumulates in the neuronal growth cone and has a marked effect on the rearrangement of the actin cytoskeleton [38] An early consequence of CAP-23 accumulation is an...
- 12
- 369
- 0
Báo cáo khoa học: Specific degradation of H. pylori urease by a catalytic antibody light chain pptx
... kDa) and (5; 16.5 kDa) were faintly observed immediately after mixing (lane 1) At h of incubation (lane 2), the bands of partially dissociated urease (am b n) became faint as well as the band of ... little change At h of incubation (lane 3), the band of the b-subunit became very faint Some new bands between bands and became clearer and several bands around bands and also became darker The band ... Catalytic features of anti-HpU-9 mAb light chain light and ⁄ or heavy chains from mAbs such as i41–7 [13], i41SL1-2 [14], and ECL2B [15] The light chain of ECL2B mAb was capable of cleaving a...
- 9
- 388
- 0
Báo cáo khoa học: Netropsin interactions in the minor groove of d(GGCCAATTGG) studied by a combination of resolution enhancement and ab initio calculations pot
... No of nonsolvent atoms No of water molecules ˚ Average B-values of DNA (A2 ) ˚ Average B-values of Nt (A2 ) ˚ Average B-values of water molecules (A2 ) ˚ Rmsd of bond lengths (A) Rmsd of bond angles ... the DNA (seven contain an AATT tract and two contain a mixed ATAT tract) Only three structures, GDLB31 [9], GDL014 [11] and GDJ046 [12], are class I structures containing a CAATTG tract and are ... amidinium end The contact area of the Nt amidinium end (NAE) was investigated by evaluating the interaction energies and hydrogen positions of the end fragment and the bases of base pair T8 -A2 5...
- 11
- 483
- 0
Báo cáo Y học: Identification of novel membrane proteins by searching for patterns in hydropathy profiles potx
... members of a family or functional class of membrane protein It can assist with functional analysis, and may also be useful in proteome database annotation METHODS An algorithm was developed for searching ... accepted only if they had between 10 and 13 peaks, arranged as a pair of peaks, followed by a deep valley (< )1.9), then a cluster We have developed and tested an algorithm that can scan a large ... hydropathy peaks, but they are organized in a different pattern The peaks occur in two pairs separated by a deep valley pairs, which are separated by an intracellular hydrophilic loop (Fig 2D) Many...
- 7
- 407
- 0
preparation of fe2o3 submicro - flowers by a hydrothermal approach
... through a hydrothermal method using Span80 or L113B as a soft template [17] Wan et al have proposed a soft-template-assisted hydrothermal route to prepare single crystal nanorods with an average diameter ... voltage increases, and the amplitude of the plateau is markedly reduced, so that only a discharge slope is observed, with a decrease in the discharge capacity The initial discharge capacities of ... Probably due to the fine particle size and large surface area, the material shows superior electrochemical performance, with a high initial capacity of 905.8 mAh/g and good capacity retention of...
- 6
- 382
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella ... likely that Prasinophytes also contain PsbQ The thylakoid membranes of P parkeae and E gracilis did not react with any antibodies against the red algal and cyanobacterial extrinsic proteins (lanes ... represented by Cyanophora paradoxa, are a group of unique photosynthetic eukaryotes that possess a special type of plastid called cyanelle The cyanelle is surrounded by a peptidoglycan wall [20] and...
- 11
- 501
- 0
Báo cáo khoa học: Monitoring the prevention of amyloid fibril formation by a-crystallin Temperature dependence and the nature of the aggregating species pdf
... (A Rekas, unpublished data on a- synuclein and j-casein) From the Arrhenius law, we have: ln(kapp) ¼ – EA ⁄ RT + ln (A) The activation energy of fibril formation (EA) was calculated (Table 1) as ... which was particularly pronounced in the case of the native j-casein and a- crystallin mixture, where significant conformational flexibility was indicated by the appearance of additional cross-peaks ... inhibition of j-casein fibrillation by a- crystallin is a function of both ‘activating’ the chaperone ability of a- crystallin, and of the effects of a- crystallin on j-casein, which have not been, as yet,...
- 16
- 577
- 0
Báo cáo khoa học: The histidine-phosphocarrier protein of Streptomyces coelicolor folds by a partially folded species at low pH ppt
... Fitting of the calculated erfc)1(r) to the above equation by linear least-squares analysis was carried out with KALEIDAGRAPH (Abelbeck software) working on a PC computer Once the calibration parameters ... were carried out by using the general curve fit option of KALEIDAGRAPH (Abelbeck software) Gel filtration chromatography Analytical gel filtration experiments were carried out by using an analytical ... thank Xavier Aviles for acquiring the mass spectra in his laboratory We deeply thank May Garcı´ a, M Carmen Fuster, Javier Casanova and M T Garzon for excellent technical assistance This work was...
- 14
- 353
- 0
Treatment of enterococcus faecalis bacteria by a helium atmospheric cold plasma brush with oxygen addtion
... not damage heat-sensitive materials, and may be touched by humans without any harm.1 However, the available atmospheric plasma sterilization processes in current medical uses have some drawbacks ... temperature atmospheric pressure plasmas, which are partially ionized gases, is attracting significant attention.19–22 Very recently, a roomtemperature, battery-operated, handheld air plasma jet was ... study on inactivation of Enterococcus faecalis bacteria by means of an atmospheric cold plasma brush driven by an ac power a) Wei Chen and Jun Huang contributed equally to this work Author to whom...
- 5
- 430
- 0
Most cases of STEMI are caused by a thrombotic occlusion of a larger coronary artery (5). The pptx
... Hiratzka LF, Hunt SA, Jacobs AK; American College of Cardiology; American Heart Association Task Force on Practice Guidelines; Canadian Cardiovascular Society ACC/AHA guidelines for the management ... cardiac events of long-term (1-year) treatment of the combination of clopidogrel plus ASA compared to ASA alone has been proven in patients with unstable angina and non-ST-elevation myocardial ... thrombolysis as well as the time point of angiography and eventually PCI The pharmacoinvasive treatment strategy is supported by recent registry data (82-84) and study data (85) Facilitated PCI In contrast...
- 12
- 323
- 1
Báo cáo sinh học: " Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple steps" pptx
... mycTAAs: 5'tcgaggaacaaaaactcatctcagaagaggatctgtaat and mycTAAa: 5'-ctagattacagatcctcttctgagatgagtttttgttcc into the expression plasmid containing the RSV-F ORF lacking the stop codon via XhoI and ... (Primers (Sigma): sense: 5'-gatccaagcttccaccatggagttgccaatcctcaaa; antisense: 5'-tcgacctcgagttagttactaaatgcaatattatttatacc) using the Platinum® Taq DNA-polymerase (Invitrogen) The 1.7 kb fragment including ... achieved by replacement of a SacII/HindIII fragment by the annealed oligonucleotides (Sigma, Munich, Germany) Is (5'ggccgggaacggtgcattggaacgcggattccccgtgccaagagtgactcaccgtccttgacacga) and Ia (5'agcttcgtgtcaaggacggtgagtcactcttggcacggggaatccgcgttccaatgcaccgttcccggccgc)...
- 10
- 409
- 1
Báo cáo sinh học: " Rapid label-free identification of mixed bacterial infections by surface plasmon resonance" pdf
... 5’-CGGCGTGCCTAATACATG-3’ 5’-cgccccGTAGGAGTCTGGACCGTGTC-3’ S aureus 5’-SH-ACAGCAAGACCGTCTTTCACTTTTG-3’ P aeruginosus C tetanus 5’-SH-CCACTTTCTCCCTCAGGACGTATG-3’ 5’-SH-GCCCATCTCAAAGCAGATTACTC-3’ C ... S aureus 5’-ACAGCAAGACCGTCTTTCACTTTTC-3’ Wang et al Journal of Translational Medicine 2011, 9:85 http://www.translational-medicine.com/content/9/1/85 Page of Preparation of bacterial DNA Calibration ... quantitatively analyzed using an image analysis software The sensitivity, specificity and reproducibility of this method were also evaluated Materials and Methods Materials and reagents Standard...
- 9
- 288
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu