identification of intrinsically disordered proteins by a special 2d electrophoresis

... Decay rates of human mRNAs: correlation with functional characteristics and sequence attributes Genome Res 2003, 13:1863-1872 Raghavan A, Bohjanen PR: Microarray-based analyses of mRNA decay ... YKE carried out the miRNA and ubiquitin target analysis and drafted the major part of the manuscript AEL carried out the microarray analysis, ubiquitin predictions and function analysis and assisted ... disordered proteins (Figures 1d and 2d; Figure S1c in Additional data file 1) Additionally, the method and the materials of Chen et al [83] provide an estimate of miRNA targeting higher than our analysis...

Ngày tải lên: 14/08/2014, 21:20

... Allen, 1978b), algae and terrestrial plants (Allen and Allen, 197 8a) , and animals (Niwayama et al., 2011) In plants and animals, cytoplasmic streaming is generated by actin and myosin and plays ... 850 and 900 Da (Lucas and Wolf, 1993) and can be regulated to allow the passage of molecules as large as 20 kDa such as proteins and nucleic acids The regulation of plasmodesmata SEL is important ... and Balasubramaniam lab for useful discussion and general camaraderie and also for being a reliable source of rare reagents Life at the institute would not be the same without the interaction and...

Ngày tải lên: 09/09/2015, 11:09

... from the NIH AIDS Reagent Repository) was Flag-tagged at the 5¢-end by PCR using the primers 5¢-CTGCAGCATGGACTACAAGGACGACGA TGACAAGGAGAGTTGCTACAACCCAGGTCTG-3¢ and 5¢-GAGAGTTGCTACAACCCAGGTCTG-3¢ ... 5¢-GCGGCGGCCTGCCGACCGG GAGCTCAGT-3¢ for S27 6A and 5¢-AAACGTAAAAG GGCATATGAGACCTTCAAGAGCATC-3¢ for T30 5A (mutations in bold) The accuracy of the mutations was confirmed by DNA sequencing p49 (obtained from ... (Promega, sense 5¢-TGTCG AATGCAAATCACTAGAA-3¢), H2K (sense 5¢-GGATC CCGGTCGGGGGATTCCCCATCTCGG-3¢), j enhancer (sense 5¢-AGCAGAGGGGACTTTCCGAGGC-3¢) The custom made oligonucleotides were obtained as...

Ngày tải lên: 08/03/2014, 02:20

... Hinuma Y, Nagata K, Hanaoka M, Nakai M, Matsumoto T, Kinoshita KI, Shirakawa S, Miyoshi I: Adult T-cell leukemia: antigen in an ATL cell line and detection of antibodies to the antigen in human ... I Tax oncoprotein: cellular signaling through NFkappa B Cytokine Growth Factor Rev 2001, 12:207-217 Sun SC, Yamaoka S: Activation of NF-kappaB by HTLV-I and implications for cell transformation ... structure localization signal are required for Tax nuclear localization J Virol 2009, 83:5339-5352 23 24 25 26 27 Hirata A, Higuchi M, Niinuma A, Ohashi M, Fukushi M, Oie M, Akiyama T, Tanaka Y, Gejyo...

Ngày tải lên: 12/08/2014, 04:21

... Malayaman N, Hu Z, Liang TJ Decay accelerating factor Regulation of [16, 17] Structural and functional characterization of interaction between for complement (DAF) complement activation hepatitis ... selected randomly for PCR amplification Size of individual inserts reflected by the size of the amplified PCR product was analysed on an agarose gel Lane to 22, PCR product from each of the 22 randomly ... Nanyang Technological University, Singapore QC Toh and WQ Teo are from Ngee Ann Polytechnic, Singapore CY Ho and S Parida are undergraduate students from School of Biological Sciences, Nanyang...

Ngày tải lên: 02/11/2012, 11:08

... 5Â-GGAGATCTAAAATGGACGACTGGGAGGAAGA-3Â and 5Â-GCGAATTCGTTGAAAACTTTTAATTATCA GGAGAAAAC-3Â, 5Â-CGAGATCTAGCATGTCAGACG TGGAGTCTGGA-3Â and 5Â-GCGAATTCGCAACCAAA GACAACCTGGTTTTAATGTTTTGA-3Â, and 5Â-CGAG ATCTGAAATGAACGAGCTGCGTATGCCGAA-3Â ... 5Â-GCGCTAGCTAAT ACGACTCACTATAGGGAGATCTAAAATGGACGAC TGGGAGGAAGA-3Â and 5Â-GCGAATTCGTTGAAA ACTTTTAATTATCAGGAGAAAAC-3Â This PCR fragment has a T7 promoter for RNA synthesis Capped RNA was synthesized by ... ATCTGAAATGAACGAGCTGCGTATGCCGAA-3Â and 5Â-GCGAATTCAACACAAGAGTTGTTTTATATTGAA CCCA-3Â, respectively The PCR product was digested and ligated into the multiple cloning site of pEGFP-Cl (Clontech, Palo...

Ngày tải lên: 18/02/2014, 16:20

... protein by phage display coupled with proteolysis and structural characterization by NMR and X-ray crystallography J Mol Biol 323, 253–262 19 Regan, L & DeGrado, W.F (1988) Characterization of a helical ... genes For small protein domains, they may have evolved by assembly and/or exchange of small gene segments, leading to diversification of the domain architecture and even generation of an entirely ... absence of any cofactors In this work, the authors used the method similar to that of Finucane et al [11] except that the protein A B-domain instead of His-tag was used to select the folded proteins...

Ngày tải lên: 19/02/2014, 12:20

... Proceedings of EACL '99 Masahiro Oku and Koji Matsuoka 1997 A Method for Detecting Japanese Homophone Errors in Compound Nouns based on Character Cooccurrence and Its Evaluation (in Japanese) Journal of ... Koji Tochinai, Taisuke Itoh, and Yasuhiro Suzuki 1986 Kana-Kanji Translation System with Automatic Homonym Selection Using Character Chain Matching (in Japanese) Journal of Information Processing, ... est(wh,ej) among 5As in this paper, the addition of a small value is an easy and effective way to avoid the unsatisfactory case, as shown in (Yarowsky, 1994) 182 760 ~.~ ¢ ) + (of+ ) , 0.358...

Ngày tải lên: 22/02/2014, 03:20

... membrane targeting of myristoylated and palmitoylated proteins Biochim Biophys Acta 1451, 1–16 Gratzer WB (1970) Numerical values of the absorbances of the aromatic amino acids In Handbook of Biochemistry: ... related proteins, function to enhance the accumulation and assembly of PtdIns(4, 5)P2-rich raft domains [36] During neuronal development, axonal elongation and branching are regulated by the activity ... growth and development CAP-23 accumulates in the neuronal growth cone and has a marked effect on the rearrangement of the actin cytoskeleton [38] An early consequence of CAP-23 accumulation is an...

Ngày tải lên: 07/03/2014, 17:20

... kDa) and (5; 16.5 kDa) were faintly observed immediately after mixing (lane 1) At h of incubation (lane 2), the bands of partially dissociated urease (am b n) became faint as well as the band of ... little change At h of incubation (lane 3), the band of the b-subunit became very faint Some new bands between bands and became clearer and several bands around bands and also became darker The band ... Catalytic features of anti-HpU-9 mAb light chain light and ⁄ or heavy chains from mAbs such as i41–7 [13], i41SL1-2 [14], and ECL2B [15] The light chain of ECL2B mAb was capable of cleaving a...

Ngày tải lên: 07/03/2014, 21:20

... No of nonsolvent atoms No of water molecules ˚ Average B-values of DNA (A2 ) ˚ Average B-values of Nt (A2 ) ˚ Average B-values of water molecules (A2 ) ˚ Rmsd of bond lengths (A) Rmsd of bond angles ... the DNA (seven contain an AATT tract and two contain a mixed ATAT tract) Only three structures, GDLB31 [9], GDL014 [11] and GDJ046 [12], are class I structures containing a CAATTG tract and are ... amidinium end The contact area of the Nt amidinium end (NAE) was investigated by evaluating the interaction energies and hydrogen positions of the end fragment and the bases of base pair T8 -A2 5...

Ngày tải lên: 16/03/2014, 22:20

... members of a family or functional class of membrane protein It can assist with functional analysis, and may also be useful in proteome database annotation METHODS An algorithm was developed for searching ... accepted only if they had between 10 and 13 peaks, arranged as a pair of peaks, followed by a deep valley (< )1.9), then a cluster We have developed and tested an algorithm that can scan a large ... hydropathy peaks, but they are organized in a different pattern The peaks occur in two pairs separated by a deep valley pairs, which are separated by an intracellular hydrophilic loop (Fig 2D) Many...

Ngày tải lên: 17/03/2014, 23:20

... through a hydrothermal method using Span80 or L113B as a soft template [17] Wan et al have proposed a soft-template-assisted hydrothermal route to prepare single crystal nanorods with an average diameter ... voltage increases, and the amplitude of the plateau is markedly reduced, so that only a discharge slope is observed, with a decrease in the discharge capacity The initial discharge capacities of ... Probably due to the fine particle size and large surface area, the material shows superior electrochemical performance, with a high initial capacity of 905.8 mAh/g and good capacity retention of...

Ngày tải lên: 20/03/2014, 13:06

... Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella ... likely that Prasinophytes also contain PsbQ The thylakoid membranes of P parkeae and E gracilis did not react with any antibodies against the red algal and cyanobacterial extrinsic proteins (lanes ... represented by Cyanophora paradoxa, are a group of unique photosynthetic eukaryotes that possess a special type of plastid called cyanelle The cyanelle is surrounded by a peptidoglycan wall [20] and...

Ngày tải lên: 23/03/2014, 15:21

... (A Rekas, unpublished data on a- synuclein and j-casein) From the Arrhenius law, we have: ln(kapp) ¼ – EA ⁄ RT + ln (A) The activation energy of fibril formation (EA) was calculated (Table 1) as ... which was particularly pronounced in the case of the native j-casein and a- crystallin mixture, where significant conformational flexibility was indicated by the appearance of additional cross-peaks ... inhibition of j-casein fibrillation by a- crystallin is a function of both ‘activating’ the chaperone ability of a- crystallin, and of the effects of a- crystallin on j-casein, which have not been, as yet,...

Ngày tải lên: 30/03/2014, 04:20

... Fitting of the calculated erfc)1(r) to the above equation by linear least-squares analysis was carried out with KALEIDAGRAPH (Abelbeck software) working on a PC computer Once the calibration parameters ... were carried out by using the general curve fit option of KALEIDAGRAPH (Abelbeck software) Gel filtration chromatography Analytical gel filtration experiments were carried out by using an analytical ... thank Xavier Aviles for acquiring the mass spectra in his laboratory We deeply thank May Garcı´ a, M Carmen Fuster, Javier Casanova and M T Garzon for excellent technical assistance This work was...

Ngày tải lên: 31/03/2014, 01:20

... not damage heat-sensitive materials, and may be touched by humans without any harm.1 However, the available atmospheric plasma sterilization processes in current medical uses have some drawbacks ... temperature atmospheric pressure plasmas, which are partially ionized gases, is attracting significant attention.19–22 Very recently, a roomtemperature, battery-operated, handheld air plasma jet was ... study on inactivation of Enterococcus faecalis bacteria by means of an atmospheric cold plasma brush driven by an ac power a) Wei Chen and Jun Huang contributed equally to this work Author to whom...

Ngày tải lên: 18/05/2014, 20:36

... Hiratzka LF, Hunt SA, Jacobs AK; American College of Cardiology; American Heart Association Task Force on Practice Guidelines; Canadian Cardiovascular Society ACC/AHA guidelines for the management ... cardiac events of long-term (1-year) treatment of the combination of clopidogrel plus ASA compared to ASA alone has been proven in patients with unstable angina and non-ST-elevation myocardial ... thrombolysis as well as the time point of angiography and eventually PCI The pharmacoinvasive treatment strategy is supported by recent registry data (82-84) and study data (85) Facilitated PCI In contrast...

Ngày tải lên: 18/06/2014, 12:20

... mycTAAs: 5'tcgaggaacaaaaactcatctcagaagaggatctgtaat and mycTAAa: 5'-ctagattacagatcctcttctgagatgagtttttgttcc into the expression plasmid containing the RSV-F ORF lacking the stop codon via XhoI and ... (Primers (Sigma): sense: 5'-gatccaagcttccaccatggagttgccaatcctcaaa; antisense: 5'-tcgacctcgagttagttactaaatgcaatattatttatacc) using the Platinum® Taq DNA-polymerase (Invitrogen) The 1.7 kb fragment including ... achieved by replacement of a SacII/HindIII fragment by the annealed oligonucleotides (Sigma, Munich, Germany) Is (5'ggccgggaacggtgcattggaacgcggattccccgtgccaagagtgactcaccgtccttgacacga) and Ia (5'agcttcgtgtcaaggacggtgagtcactcttggcacggggaatccgcgttccaatgcaccgttcccggccgc)...

Ngày tải lên: 18/06/2014, 18:20

... 5’-CGGCGTGCCTAATACATG-3’ 5’-cgccccGTAGGAGTCTGGACCGTGTC-3’ S aureus 5’-SH-ACAGCAAGACCGTCTTTCACTTTTG-3’ P aeruginosus C tetanus 5’-SH-CCACTTTCTCCCTCAGGACGTATG-3’ 5’-SH-GCCCATCTCAAAGCAGATTACTC-3’ C ... S aureus 5’-ACAGCAAGACCGTCTTTCACTTTTC-3’ Wang et al Journal of Translational Medicine 2011, 9:85 http://www.translational-medicine.com/content/9/1/85 Page of Preparation of bacterial DNA Calibration ... quantitatively analyzed using an image analysis software The sensitivity, specificity and reproducibility of this method were also evaluated Materials and Methods Materials and reagents Standard...

Ngày tải lên: 18/06/2014, 19:20