helpful expression in a biz letter

helpful expression in a biz letter

helpful expression in a biz letter

... you … • Once again, we thank you for your … and look forward to your early reply HELPFUL EXPRESSION HELPFUL EXPRESSION IN A BUSINESS LETTER IN A BUSINESS LETTER 1. Stating the reference, ... be helpful if you can… 4. Thanking, informing 4. Thanking, informing • Thank you for… • We were very pleased to inform you that… • We have much pleasure in informing...

Ngày tải lên: 08/05/2014, 20:04

12 331 0
How to write a biz letter

How to write a biz letter

... • Ways of starting a letter: We are writing to enquire about … I am writing in connection with … We are interested in … and we would like to know … • Ways of referring to a letter / invoice ... S. James Key phrases • Opening and closing greetings: Dear Sir or Madam / Sir / Madam → →→ → Yours faithfully Dear Mr / Mrs / Miss / Ms Smith → →→ → Yours sincerely Dea...

Ngày tải lên: 08/05/2014, 20:02

2 515 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

... tgccaccgct gagcaataac 320 321 tagcataccc cttggggcct ctaaacgggt cttgaggggt 360 361 TTTTTGCTGA AAGGAGGAAC TATATCCGGA TATCCCGCAA 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT ... cttaaggtatactcgccgtcgcgtaccgccgcacacgggcttt gaattccatatg agcggcagcgatggcggcgtgtgcccgaaa M S G S D G G V C P K taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgatt...

Ngày tải lên: 12/02/2014, 10:20

9 497 0
Báo cáo " Training students’ self-expression in English through portfolio assessment: A trial in English literature " pptx

Báo cáo " Training students’ self-expression in English through portfolio assessment: A trial in English literature " pptx

... Even a more able student in the group wrote: “… writing my ideas in a logical and readable way can be considered the main obstacle.” [Mai Anh] Class discussions and presentations also reveal ... Last Leaf by O’Henry are not only exquisite in language but also original in idea: “… Behrman’s death is not a normal death but an incarnation into his masterpiece, the picture o...

Ngày tải lên: 05/03/2014, 12:20

8 365 1
Báo cáo khoa học: Adipophilin protein expression in muscle – a possible protective role against insulin resistance pot

Báo cáo khoa học: Adipophilin protein expression in muscle – a possible protective role against insulin resistance pot

... predominant FA in olive oil is oleic acid and the unsaturated ⁄ satu- rated FA ratio is 4.6. Safflower oil contains oleic acid and linoleic acid and the ratio between unsaturated FA and saturated FA ... results obtained in the present study indicate that adipophilin protein expression in muscle is involved in maintaining insulin sensitivity. Abbreviations Adfp, adipophilin; CLB, clas...

Ngày tải lên: 06/03/2014, 09:22

13 373 0
Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf

Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf

... AACEVAPD1, 3 and 6, TAA is used as an Acetabularia-specific codon usage (translated as Gln). Conversion of TAA to CAA was performed by PCR as described below. AACEVAPD1 has two TAA codons in its ... cerevisiae V-ATPase was a gift from R. Hirata of the Institute of Physical and Chemical Research (Wako, Japan), and the antibody against the 100-kDa (a) subunit of S. cerevisiae V-ATPase was pu...

Ngày tải lên: 08/03/2014, 23:20

8 392 0
Báo cáo khoa học: Structure of FocB – a member of a family of transcription factors regulating fimbrial adhesin expression in uropathogenic Escherichia coli pdf

Báo cáo khoa học: Structure of FocB – a member of a family of transcription factors regulating fimbrial adhesin expression in uropathogenic Escherichia coli pdf

... Interestingly, substitution of Arg61 and Arg81 impair DNA-binding in PapB, indi- cating that these residues are critical for DNA-binding also in FocB [25]. The DNA-recognition domain of RNA polymerase r E -factor, ... (A) Subunits forming Interface-I are colored in light and dark blue; subunits of Interface-II are colored in light and dark coral. (B) Interactions in Interface-I. (C)...

Ngày tải lên: 15/03/2014, 23:20

14 459 0
Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp. PCC 6803 ppt

Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp. PCC 6803 ppt

... PCR, using primers 5¢-ATTTCGATCATGCAGGCCG-3¢ and 5¢-GGAAGAAC CGTGCATTACC-3¢, and labeled with [a- 32 P]dCTP using a Megaprime labeling kit (Amersham Pharmacia, Piscataway, NJ, USA). Hybridization ... PO & Matthews RG (2002) Adaptation to famine: a family of stationary-phase genes revealed by microarray analysis. Proc Natl Acad Sci USA 99, 13471–13476. 30 Glatz A, Horva ´ th I, Varva...

Ngày tải lên: 16/03/2014, 04:20

12 395 0
Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf

Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf

... (forward, 5¢-AAG GCT TAC CAC GAG CAG CTA TCA-3¢; reverse, 5¢-ACA GGC CAT GTA CTT TCC GTG TCT-3¢) and tobacco (forward, 5¢-ATG AGA GAG TGC ATA TCG AT-3¢; reverse, 5¢-TTC ACT GAA GGT GTT GAA-3¢) a- tubulin- specific ... attached to a transilluminating base (Diagnostic Instruments, Sterling Heights, MI, USA). Photographs were taken using an Axio- Cam MRc 5 camera that was attached to the micro...

Ngày tải lên: 16/03/2014, 06:20

16 454 0
Báo cáo Y học: Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants docx

Báo cáo Y học: Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants docx

... fixed and stained with an anti- (human J-chain) Ig to verify the presence of intracellular J-chain. A further attempt to directly quantify the amount of intracellular J-chain was avoided, as retention ... 3207 complexing of IgA and J-chain is a prerequisite for SC binding. Therefore, the correlation between the IgA and SC levels in all the clones demonstrated that a sufficient amount of...

Ngày tải lên: 18/03/2014, 01:20

6 371 0
w