helpful expression in a biz letter

... you … • Once again, we thank you for your … and look forward to your early reply HELPFUL EXPRESSION HELPFUL EXPRESSION IN A BUSINESS LETTER IN A BUSINESS LETTER 1. Stating the reference, ... be helpful if you can… 4. Thanking, informing 4. Thanking, informing • Thank you for… • We were very pleased to inform you that… • We have much pleasure in informing...

Ngày tải lên: 08/05/2014, 20:04

... • Ways of starting a letter: We are writing to enquire about … I am writing in connection with … We are interested in … and we would like to know … • Ways of referring to a letter / invoice ... S. James Key phrases • Opening and closing greetings: Dear Sir or Madam / Sir / Madam → →→ → Yours faithfully Dear Mr / Mrs / Miss / Ms Smith → →→ → Yours sincerely Dea...

Ngày tải lên: 08/05/2014, 20:02

... tgccaccgct gagcaataac 320 321 tagcataccc cttggggcct ctaaacgggt cttgaggggt 360 361 TTTTTGCTGA AAGGAGGAAC TATATCCGGA TATCCCGCAA 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT ... cttaaggtatactcgccgtcgcgtaccgccgcacacgggcttt gaattccatatg agcggcagcgatggcggcgtgtgcccgaaa M S G S D G G V C P K taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgatt...

Ngày tải lên: 12/02/2014, 10:20

... Even a more able student in the group wrote: “… writing my ideas in a logical and readable way can be considered the main obstacle.” [Mai Anh] Class discussions and presentations also reveal ... Last Leaf by O’Henry are not only exquisite in language but also original in idea: “… Behrman’s death is not a normal death but an incarnation into his masterpiece, the picture o...

Ngày tải lên: 05/03/2014, 12:20

... predominant FA in olive oil is oleic acid and the unsaturated ⁄ satu- rated FA ratio is 4.6. Safflower oil contains oleic acid and linoleic acid and the ratio between unsaturated FA and saturated FA ... results obtained in the present study indicate that adipophilin protein expression in muscle is involved in maintaining insulin sensitivity. Abbreviations Adfp, adipophilin; CLB, clas...

Ngày tải lên: 06/03/2014, 09:22

... AACEVAPD1, 3 and 6, TAA is used as an Acetabularia-specific codon usage (translated as Gln). Conversion of TAA to CAA was performed by PCR as described below. AACEVAPD1 has two TAA codons in its ... cerevisiae V-ATPase was a gift from R. Hirata of the Institute of Physical and Chemical Research (Wako, Japan), and the antibody against the 100-kDa (a) subunit of S. cerevisiae V-ATPase was pu...

Ngày tải lên: 08/03/2014, 23:20

... Interestingly, substitution of Arg61 and Arg81 impair DNA-binding in PapB, indi- cating that these residues are critical for DNA-binding also in FocB [25]. The DNA-recognition domain of RNA polymerase r E -factor, ... (A) Subunits forming Interface-I are colored in light and dark blue; subunits of Interface-II are colored in light and dark coral. (B) Interactions in Interface-I. (C)...

Ngày tải lên: 15/03/2014, 23:20

... PCR, using primers 5¢-ATTTCGATCATGCAGGCCG-3¢ and 5¢-GGAAGAAC CGTGCATTACC-3¢, and labeled with [a- 32 P]dCTP using a Megaprime labeling kit (Amersham Pharmacia, Piscataway, NJ, USA). Hybridization ... PO & Matthews RG (2002) Adaptation to famine: a family of stationary-phase genes revealed by microarray analysis. Proc Natl Acad Sci USA 99, 13471–13476. 30 Glatz A, Horva ´ th I, Varva...

Ngày tải lên: 16/03/2014, 04:20

... (forward, 5¢-AAG GCT TAC CAC GAG CAG CTA TCA-3¢; reverse, 5¢-ACA GGC CAT GTA CTT TCC GTG TCT-3¢) and tobacco (forward, 5¢-ATG AGA GAG TGC ATA TCG AT-3¢; reverse, 5¢-TTC ACT GAA GGT GTT GAA-3¢) a- tubulin- specific ... attached to a transilluminating base (Diagnostic Instruments, Sterling Heights, MI, USA). Photographs were taken using an Axio- Cam MRc 5 camera that was attached to the micro...

Ngày tải lên: 16/03/2014, 06:20

... fixed and stained with an anti- (human J-chain) Ig to verify the presence of intracellular J-chain. A further attempt to directly quantify the amount of intracellular J-chain was avoided, as retention ... 3207 complexing of IgA and J-chain is a prerequisite for SC binding. Therefore, the correlation between the IgA and SC levels in all the clones demonstrated that a sufficient amount of...

Ngày tải lên: 18/03/2014, 01:20