pro android c with the ndk
pro android c with the ndk
... already contains a sub directory called android- ndk- r8 that contains the Android NDK files. Make a note of the destination directory. 3. Click the Extract button to install Android NDK. The binary ... www.it-ebooks.info 9CHAPTER 1: Getting Started with C+ + on Android 6. When the download completes, right-click the ZIP file and choose Extract All from the...
Ngày tải lên: 28/04/2014, 16:44
Pro Android Python with SL4A ppt
... However, because it’s a widely accepted convention, you’ll want to stick with it to avoid any potential issues. Technically, self is a reference to the class or function itself. Methods within a class ... escape characters that would otherwise have a special meaning, including the backslash character itself. If you prefix a string literal with either lower or uppercase “r,” you don...
Ngày tải lên: 23/03/2014, 02:20
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf
... (P 3C) , CATGTATTT (P 4C) , CATGGCTTT (P 5C) , CATCTCTTT (P 6C) , CAGGTCTTT (P 7C) , CGTGTCTTT (P 8C) , and TATGTCTTT (P 9C) , were also synthesized chemically. The underlined sequences are changes from the ... by PCR using speci c primer sets, namely, Hi_pDEDF (5¢- ACGCGTCGACGTCGGA AATGGAGGAGTGACGG-3¢), Hi_pDEDR (5¢- CG GGATCCCGTTAATAAAAGCCTGTTGCTGGTT-3¢), Hi_Nterm F (5¢- ACGCGTCGACGTCA...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
... pBS-DC10 a 75-bp insert. The pBS-MARCKS 52 nt CU-element plasmid (pBS- MARCKS 52 nt) was constructed by annealing the two synthetic oligonucleotides (sense: 5¢-CCC CGG GCC CGA ATT CCT TTC TTT CTT ... transfection with a chimeric luciferase-MARCKS construct and for transient transfection with the cDNAs coding for human HuD and HuR. The mouse embryonic carcinoma cell line PCC7-Mz1 i...
Ngày tải lên: 08/03/2014, 08:20
Android Programming with Tutorials from the anddev.org-Community pdf
... new screen. In this case, the media player activity could start a service using Context.startService() to run in the background to keep the music going. The system will then keep the music playback ... service, you can communicate with it through an interface exposed by the service. For the music service, this might allow you to pause, rewind, etc. Content Provider Appl...
Ngày tải lên: 10/03/2014, 16:20
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc
... MS. Covalent cross-linking approaches allow: (a) the iden- tification of surface areas involved in protein-protein interactions within protein complexes; (b) the character- ization of the distance ... S (2001) Structure of the globular region of the prion pro- tein Ure2 from the yeast Saccharomyces cerevisiae. Structure (Camb.) 9, 39–46. 9 Sinz A (2006) Chemical cross-linking and...
Ngày tải lên: 15/03/2014, 00:20
Báo cáo khoa học: Interaction of an 40 kDa protein from regenerating rat liver with the )148 to )124 region of c-jun complexed with RLjunRP coincides with enhanced c-jun expression in proliferating rat liver pdf
... Laboratories, Hercules, CA, USA) according to the manufacturer’s instructions. The isoelectric focussing (IEF) gel c omposition was similar to that described by O’Farrell [39]. The concentrations of the a ... bind to their speci c recognition site with higher affi nity [40], these factors c ould form a complex even in the presence of several thousan d-fold excess o f nonspe- c...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Interaction of caspase-3 with the cyclic GMP binding cyclic GMP specific phosphodiesterase (PDE5a1) potx
... by amplifying the ORF using primers ApaI-Koz-PDE5A1- FOR(AAGGGCCCGCCACCATGGAGAGGG CCG GCC CCG GCT) and XbaI-PDE5A1REV (GCT TCTAGACTCAGTTCCGCTTGGTCTGGCTGC TTT CAC), digesting the product and the vector with ... plasmid with 125 ng of the forward primer, PDE5MUTF (GAC CAA GGA GCT AGA GAG AGG AAA GAA CTC) and the reverse primer, PDE5MUTR (GAG TTC TTT CCT CTC TCT AGC TCC TTG GTC) in...
Ngày tải lên: 17/03/2014, 09:20
Báo cáo khoa học: A pathway through interferon-c is the main pathway for induction of nitric oxide upon stimulation with bacterial lipopolysaccharide in mouse peritoneal cells pot
... AAC AGT TAT GCA AAA TAG CTC TGC AGA GCC TGG AGG GGT CGA-3¢) [12] and the IRF-1 consensus sequence oligo- nucleotide (5¢-GGA AGC GAA AAT GAA ATT GAC T-3¢) were constructed as probes for EMSA. The ... produced IFN -c in LPS-induced NO pro- duction was thought to occur. In the present study, we aimedtoclarifytheroleofIFN -c in LPS-induced NO production and revealed the important role...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot
... Thus, the configuration at the hemiacetal carbon of galactose may affect the dissociation constants. By contrast, because chemical-shift changes upon the addition of sugars at subdomain c were in the ... interacted with subdomain c of EW29Ch [25]. This interaction may be an artifact caused by the crystallization of lactose-liganded EW29Ch because: (a) in the other EW29Ch mo...
Ngày tải lên: 23/03/2014, 04:21