an oh maser flare with a strong magnetic field in w75n

Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

... including the relevant genes. By using primers TEHA1: ACACAGATCTCTGCA- GGGCACCCCAGGCTTTACA and TEHA2: ACACCC- ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified. TEHA3: ACACAGATCTCTGCAGTGAAATG- AGCTGTTGACAATTA ... providing information about the amount of soluble produced protein was obtained from the SDS ⁄ PAGE and western blotting analyses and com- pared with the data obtained when analyzing...

Ngày tải lên: 06/03/2014, 01:20

11 445 0
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

... side chains; this feature has been aptly described by Rajan et al. as a Teflon coating that can surround a helix [16] in the case of a mixture of water and hexafluoroacetone hydrate, a mixture with ... to generate an ensemble of 100 structures by the standard protocol of simulated annealing in torsion angle space implemented in DYANA (using 6000 steps). No dihedral angle restr...

Ngày tải lên: 08/03/2014, 09:20

7 624 0
Detection of an uncharged steroid with a silicon nanowire field effect transistor

Detection of an uncharged steroid with a silicon nanowire field effect transistor

... devices using nanowire or carbon-nanotube transistors as active transducer. The sensing mechanism in an electrically based biosensor relies on an altered conductance or threshold voltage (V th ) induced ... Da for mA51 moiety). (b) The structures of 1,5-EDANS, mA51 moiety and mA51-mA51. a film of SiO 2 (thickness 30 nm) and surface modification at varied stages, such as a treatment w...

Ngày tải lên: 16/03/2014, 15:23

6 493 1
Báo cáo khoa học: Solution structure of an M-1 conotoxin with a novel disulfide linkage pdf

Báo cáo khoa học: Solution structure of an M-1 conotoxin with a novel disulfide linkage pdf

... 4,4-dimethyl-4-silapentane-1-sulfonic acid used as an internal standard. Distance restraints and structure calculations An initial survey of distance constraints was performed on a series of NOESY spectra acquired at mixing times ... different backbone scaffolds. Although M-1 and M-2 branch conotoxins are similar in size and cysteine framework, and are all abundant in mollusk- and w...

Ngày tải lên: 30/03/2014, 09:20

7 346 0
Báo cáo khoa học: Human mesotrypsin exhibits restricted S1¢ subsite specificity with a strong preference for small polar side chains docx

Báo cáo khoa học: Human mesotrypsin exhibits restricted S1¢ subsite specificity with a strong preference for small polar side chains docx

... wild-type a1 AT in a manner that was comparable with inhibition of cationic and anionic trypsins, demonstrating that Arg198 is the critical determinant of resistance against a1 AT (Fig. 2A, B). Figure 2A ... migrating between the free a1 AT and the intact serpin–protease complex. Mutating Arg122 to Ala (R12 2A) in cationic and anionic trypsins abolished the major proteolytic bands...

Ngày tải lên: 30/03/2014, 10:20

13 433 0
Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc

Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc

... estimate a mean and variance of the data forecasts. • The mean and variance of the data forecasts are then used to update the estimates of the state and its variance. The algorithm we use is that ... prices. References Australian Financial Markets Association. 2008. Australian Finan- cial Markets Report. Beechey, M. 2008. “Lowering the Anchor: How the Bank of Eng- land’s In ation-Targeting...

Ngày tải lên: 15/03/2014, 07:20

32 347 0
RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc

RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc

... expectations and in ation risk premia. Due to a lack of data we cannot do this and instead estimate in ation forward rates as part of our model. 18 in ation, a low 2-year break-even in ation rate and ... Reserve Bank of Australia. Author: finlayr at domain rba.gov.au Media Office: rbainfo@rba.gov.au 26 A. 5 In ation Expectations and the In ation Risk Premium Finally, we link our in...

Ngày tải lên: 22/03/2014, 20:20

39 395 0
Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt

Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt

... c- jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit Gene Regulation Laboratory, Center for Biotechnology, Jawaharlal ... RNE-d and fragmented calf thymus DNA was packed in a 3-mL syringe column followed by washing with binding buffer and was eluted with binding buffer containing increasing concen...

Ngày tải lên: 23/03/2014, 20:22

9 449 0
An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs

An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs

... Enhancing Performance of Solar air heater Proceedings of XVII National and VI ISHME/ASME Heat and Mass Transfer Conference, IGCAR, Kalpakkam India 2004; Jan. 05-07. [2] Han J. C. “Heat transfer ... India [22] Tariq, A. , Keshav Kant and Panigrahi, P. K., “Heat transfer enhancement using an internally threaded tube”, Proceeding of the 4th ISHMT-ASME and 15th National Conference on Heat...

Ngày tải lên: 05/09/2013, 16:10

12 831 0
Strong reproductive barriers in a narrow hybrid zone of West-Mediterranean green toads (Bufo viridis subgroup) with Plio-Pleistocene divergence pptx

Strong reproductive barriers in a narrow hybrid zone of West-Mediterranean green toads (Bufo viridis subgroup) with Plio-Pleistocene divergence pptx

... the Italian Peninsula and Sicily (Figure 1 and Table 1). Italian Peninsula was added to the sampling to allow us to understand the context of the B. balearicus invasion in Sicily and to compare ... Switzerland; and Authorisation No. 1798, Servicedelaconsommationetdes affaires vétérinaires, Canton de Vaud, Epalinges, Switzerland. Additional material Additional file 1: Table with allele siz...

Ngày tải lên: 05/03/2014, 17:20

16 429 0
w