random walks on graphs with a strong isoperimetric property

... task than factual question answering, and they point out that traditional fact-based QA ap- proaches may have difficulty on opinion QA tasks if unchanged. (Somasundaran et al., 2007) argues that ... question answering using the opqa corpus. In HLT/EMNLP. Vasudeva Varma, Prasad Pingali, Rahul Katragadda, and et al. 2008. Iiit hyderabad at tac 2008. In Text Analysis Conference. X. Wan and J Yang. ... factors. Acknowledgments: Special thanks to Derek Hao Hu and Qiang Yang for their valuable comments and great help on paper prepara- tion. We also thank Hongning Wang, Min Zhang, Xiaojun Wan and...

Ngày tải lên: 20/02/2014, 07:20

... ammann@iecn.u-nancy.fr Universit ă at Mainz, Mainz, Germany E-mail address : lauter@mathematik.uni-mainz.de Pennsylvania State University, University Park, PA E-mail address : nistor@math.psu.edu References [1] B. Ammann, A. ... previous sections remain valid, with the appropriate modifications. In particular, we ob- tain the following definition of the algebra of G-equivariant pseudodifferential operators associated to (A, M, ... we have fixed a manifold M 0 , a Lie structure at infinity (M ,A) on M 0 , and a metric g on A with injectivity radius r 0 > 0. Also, recall that any X ∈ Γ (A) ⊂V b generates a global ow X : R...

Ngày tải lên: 16/02/2014, 06:20

... lacUV5 was amplified. TEHA3: ACACAGATCTCTGCAGTGAAATG- AGCTGTTGACAATTA and TEHA4: ACACCCATGGT- CTGTTTCCTGTG were used for trc amplification. The exact nucleotide sequence of each promoter region is ... promoters lacUV5 and trc were amplified by PCR from vectors including the relevant genes. By using primers TEHA1: ACACAGATCTCTGCA- GGGCACCCCAGGCTTTACA and TEHA2: ACACCC- ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 ... GGGATGTTGAAACGCTT GTTG and GFP6_R: CGGTCACGAACTCCAGCAG, respectively. The input of total RNA was 2 lg. A mixture containing total RNA, dNTPs (Invitrogen, Carlsbad, CA, USA) and 5 pmol of each...

Ngày tải lên: 06/03/2014, 01:20

... equipped with an electrospray ion source (ESI-MS). An advantage of this approach is that information can be collected on the initial events, which take place as this organism adapts to environmental ... internal composition of each subcomplex in contrast to UV irradiation. In fact, it is well k nown that adaptation of cyanobacterial phycobilisomes to light by complementary chromatic adaptation ... the area underlying each peak. This was facilitated by the fact that the biliproteins are strongly c onserved and it may reason- ably be assumed that they have similar optical extinction coefficients;...

Ngày tải lên: 08/03/2014, 16:20

... wild-type a1 AT in a manner that was comparable with inhibition of cationic and anionic trypsins, demonstrating that Arg198 is the critical determinant of resistance against a1 AT (Fig. 2A, B). Figure 2A ... associ- ation indicated that, after correction for SI, mesotrypsin associated with a1 AT Pittsburgh almost as rapidly as cationic or anionic trypsin (Table 1). Notably, associ- ation rates for cationic ... from Qiagen (Valencia, CA). Anti-(mouse) IgG HRP conjugate was from Promega (Madison, WI). Human a1 AT purified from plasma was purchased from Calbiochem (San Diego, CA) and Sigma. Recombinant human...

Ngày tải lên: 30/03/2014, 10:20

... authors, or dismissed as showing too large a velocity separation. d From EVN data. are really new as they are related to the flare which took place between 1998 and 2000. Also, more accurate absolute ... located in two clusters around VLA1 and VLA2. Torrelles et al. (2003) have found a shell of water masers around the ultra-compact HII region VLA2 with a radius of 160 AU. The shell is expanding ... propagated in the gas of the stellar wind. 3. Conclusions A very strong magnetic field of 40 mG has been detected in several OH masers spots which have appeared during a flare of OH maser emission...

Ngày tải lên: 28/04/2014, 13:15

Ngày tải lên: 12/06/2014, 11:27

Ngày tải lên: 07/08/2014, 06:22

Ngày tải lên: 07/08/2014, 15:22

Ngày tải lên: 08/08/2014, 01:20

Ngày tải lên: 08/08/2014, 12:22

Ngày tải lên: 12/08/2014, 17:20

Ngày tải lên: 13/11/2014, 10:52

Ngày tải lên: 07/08/2014, 15:23

Ngày tải lên: 08/08/2014, 12:23

... based on an axiomatic rather than a gen- erative view of grammar, (ii) it uses a TAG-like grammar in which the basic linguistic units are trees rather than categories and (iii) it assumes a flat ... sup- port both a more precise formulation of grammars and a different perspective on the mathematical and computational properties of natural language. But eventually the question must also be ad- dressed ... variable while a neutral node variable is a variable that may not be identified with any other node variable. Formally, polari- ties are used to define the class of saturated mod- els. A saturated...

Ngày tải lên: 20/02/2014, 18:20

... vs. Americans Risk Analysis 9(3): 401-405 Koushki P A, Al-Fadhala S, Al-Saleh O, and Aljassar A H. 2002 Urban air pollution impact of modal shift in school transportation in Kuwait Journal ... animals – as well as buildings, streets, and the like.” The researchers concluded that environmental quality is no longer seen as a post-materialist value and that environmental degradation ... negative about air quality and other attributes. Such a relationship between perceptions of air pollution and indicators of local social capital and place attachment were identified by Wakefield,...

Ngày tải lên: 06/03/2014, 16:20

... hay days of the Thatcher administration, Meenaghan (1983, p. 13) noted that “in a climate of increased economic austerity government financial cutbacks in ‘marginal’ areas have created a vacuum ... “companies derive benefits, either in sales or image terms, from their involvement with a particular social or charitable cause” (Meenaghan 1998, p. 10, based on Varadarajan and Menon 1988). American ... among different audience groups at the FIS Alpine World Championships 2003. Additional qualitative data was collected by means of interviews and systematic observation. The qualitative data...

Ngày tải lên: 07/03/2014, 10:20

... Lebesgue measure class. To carry out a trans-quasiconformal surgery, we have to address two fun- damental questions: Question 1. Under what optimal arithmetical condition E DE on θ does the linearization ... and S. Zakeri To the memory of Michael R. Herman (1942–2000) Abstract Let 0 <θ<1 be an irrational number with continued fraction expansion θ = [a 1 ,a 2 ,a 3 , ], and consider the quadratic ... continued fractions; see [Kh] or [La] for more details. Let 0 <θ<1 be an irrational number and consider the continued fraction expansion θ = 1 a 1 + 1 a 2 + 1 a 3 + ··· = [a 1 ,a 2 ,a 3 , ], with a n =...

Ngày tải lên: 14/03/2014, 22:20

... operation, the fluctua- data. We thus obtained the early-stage growth rate tions were accompanied by mechanical vibrations by using the range of voltage pulse durations at which H was between 0 and ... (a) Early- and late-stage growth rates, and (b) early- tip–sample interaction. When the mobile silicon stage growth rate as a function of the tunneling current for atoms on the surface have a ... islands at a bias Fig. 2. Island height as a function of the duration of bias volt- voltage of −10 V and a tunneling current of age. Islands were grown at a negative tip bias voltage of −10 V and...

Ngày tải lên: 16/03/2014, 15:32