random walks on graphs with a strong isoperimetric property
Tài liệu Báo cáo khoa học: "Answering Opinion Questions with Random Walks on Graphs" docx
... task than factual question answering, andthey point out that traditional fact-based QA ap-proaches may have difficulty on opinion QA tasksif unchanged. (Somasundaran et al., 2007) arguesthat ... question answering usingthe opqa corpus. In HLT/EMNLP.Vasudeva Varma, Prasad Pingali, Rahul Katragadda,and et al. 2008. Iiit hyderabad at tac 2008. In TextAnalysis Conference.X. Wan and J Yang. ... factors.Acknowledgments: Special thanks to DerekHao Hu and Qiang Yang for their valuablecomments and great help on paper prepara-tion. We also thank Hongning Wang, MinZhang, Xiaojun Wan and...
- 9
- 420
- 0
Tài liệu Đề tài "Pseudodifferential operators on manifolds with a Lie structure at infinity " doc
... ammann@iecn.u-nancy.frUniversităat Mainz, Mainz, GermanyE-mail address : lauter@mathematik.uni-mainz.dePennsylvania State University, University Park, PAE-mail address : nistor@math.psu.eduReferences[1]B. Ammann, A. ... previoussections remain valid, with the appropriate modifications. In particular, we ob-tain the following definition of the algebra of G-equivariant pseudodifferentialoperators associated to (A, M, ... we have fixed a manifold M0, a Lie structure at infinity (M ,A) on M0, and a metric g on A with injectivity radius r0> 0. Also, recall thatany X ∈ Γ (A) ⊂Vbgenerates a global ow X: R...
- 32
- 324
- 0
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... lacUV5 wasamplified. TEHA3: ACACAGATCTCTGCAGTGAAATG-AGCTGTTGACAATTA and TEHA4: ACACCCATGGT-CTGTTTCCTGTG were used for trc amplification. Theexact nucleotide sequence of each promoter region is ... promoters lacUV5 and trcwere amplified by PCR from vectors including the relevantgenes. By using primers TEHA1: ACACAGATCTCTGCA-GGGCACCCCAGGCTTTACA and TEHA2: ACACCC-ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 ... GGGATGTTGAAACGCTTGTTG and GFP6_R: CGGTCACGAACTCCAGCAG,respectively. The input of total RNA was 2 lg. A mixturecontaining total RNA, dNTPs (Invitrogen, Carlsbad, CA,USA) and 5 pmol of each...
- 11
- 445
- 0
Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx
... equipped with an electrospray ionsource (ESI-MS). An advantage of this approach is thatinformation can be collected on the initial events, which takeplace as this organism adapts to environmental ... internal composition of each subcomplex incontrast to UV irradiation. In fact, it is well k nown thatadaptation of cyanobacterial phycobilisomes to light bycomplementary chromatic adaptation ... the areaunderlying each peak. This was facilitated by the fact thatthe biliproteins are strongly c onserved and it may reason-ably be assumed that they have similar optical extinctioncoefficients;...
- 9
- 477
- 0
Báo cáo khoa học: Human mesotrypsin exhibits restricted S1¢ subsite specificity with a strong preference for small polar side chains docx
... wild-type a1 AT in a manner that wascomparable with inhibition of cationic and anionictrypsins, demonstrating that Arg198 is the criticaldeterminant of resistance against a1 AT (Fig. 2A, B).Figure 2A ... associ-ation indicated that, after correction for SI, mesotrypsinassociated with a1 AT Pittsburgh almost as rapidly ascationic or anionic trypsin (Table 1). Notably, associ-ation rates for cationic ... fromQiagen (Valencia, CA). Anti-(mouse) IgG HRP conjugatewas from Promega (Madison, WI). Human a1 AT purifiedfrom plasma was purchased from Calbiochem (San Diego,CA) and Sigma. Recombinant human...
- 13
- 433
- 0
an oh maser flare with a strong magnetic field in w75n
... authors, or dismissed as showing too large a velocity separation.dFrom EVN data.are really new as they are related to the flare which took place between 1998 and 2000.Also, more accurate absolute ... located in two clustersaround VLA1 and VLA2. Torrelles et al. (2003) have found a shell of water masers aroundthe ultra-compact HII region VLA2 with a radius of 160 AU. The shell is expanding ... propagated in the gas of the stellar wind.3. Conclusions A very strong magnetic field of 40 mG has been detected in several OH masers spotswhich have appeared during a flare of OH maser emission...
- 2
- 250
- 0
Tài liệu Báo cáo khoa học: "Generating with a Grammar Based on Tree Descriptions: a Constraint-Based Approach" pptx
... based on an axiomatic rather than a gen-erative view of grammar, (ii) it uses a TAG-likegrammar in which the basic linguistic units aretrees rather than categories and (iii) it assumes a flat ... sup-port both a more precise formulation of grammarsand a different perspective on the mathematicaland computational properties of natural language.But eventually the question must also be ad-dressed ... variable while a neutral nodevariable is a variable that may not be identified with any other node variable. Formally, polari-ties are used to define the class of saturated mod-els. A saturated...
- 8
- 397
- 0
PUBLIC PERCEPTIONS OF URBAN AIR POLLUTION WITH A FOCUS ON DEVELOPING COUNTRIES potx
... vs. Americans Risk Analysis 9(3): 401-405 Koushki P A, Al-Fadhala S, Al-Saleh O, and Aljassar A H. 2002 Urban air pollution impact of modal shift in school transportation in Kuwait Journal ... animals – as well as buildings, streets, and the like.” The researchers concluded that environmental quality is no longer seen as a post-materialist value and that environmental degradation ... negative about air quality and other attributes. Such a relationship between perceptions of air pollution and indicators of local social capital and place attachment were identified by Wakefield,...
- 32
- 381
- 0
Building Brands through Event Sponsorships: Providing On-Site Audiences with a Vivid Brand Experience pdf
... hay days of the Thatcher administration, Meenaghan (1983, p. 13) noted that “in a climate of increased economic austerity government financial cutbacks in ‘marginal’ areas have created a vacuum ... “companies derive benefits, either in sales or image terms, from their involvement with a particular social or charitable cause” (Meenaghan 1998, p. 10, based on Varadarajan and Menon 1988). American ... among different audience groups at the FIS Alpine World Championships 2003. Additional qualitative data was collected by means of interviews and systematic observation. The qualitative data...
- 261
- 383
- 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
... Lebesguemeasure class.To carry out a trans-quasiconformal surgery, we have to address two fun-damental questions:Question 1. Under what optimal arithmetical condition EDE on θ doesthe linearization ... and S. ZakeriTo the memory of Michael R. Herman (1942–2000)AbstractLet 0 <θ<1 be an irrational number with continued fraction expansionθ = [a 1 ,a 2 ,a 3, ], and consider the quadratic ... continuedfractions; see [Kh] or [La] for more details. Let 0 <θ<1 be an irrationalnumber and consider the continued fraction expansionθ =1 a 1+1 a 2+1 a 3+ ···= [a 1 ,a 2 ,a 3, ], with a n=...
- 53
- 383
- 0
Effect of tunneling current on the growth of silicon islands on si(111) surfaces with a scanning tunneling microscope
... operation, the fluctua-data. We thus obtained the early-stage growth ratetions were accompanied by mechanical vibrationsby using the range of voltage pulse durations atwhich H was between 0 and ... (a) Early- and late-stage growth rates, and (b) early-tip–sample interaction. When the mobile siliconstage growth rate as a function of the tunneling current foratoms on the surface have a ... islands at a biasFig. 2. Island height as a function of the duration of bias volt-voltage of −10 V and a tunneling current ofage. Islands were grown at a negative tip bias voltage of −10 Vand...
- 7
- 434
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25