rna polymerase and associated factors, part c

Nutritional Status and Associated Factors in Institutionalized Elderly docx

... of muscle mass was observed in 21.2% of subjects, according to CP and AMBc. According to the CC classication, 59.4% of the seniors were at risk of complications associated with obesity and 70.3%, ... Muscle Area - - Severe muscle decit 11 21,2 Decit mild muscle 7 13,5 Normal muscle 30 57,7 Excess muscle 2 3,8 Muscle increased 2 3,8 Waist circumference* - - Very high risk of complic...

Ngày tải lên: 05/03/2014, 21:20

5 552 0

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

... CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC hp2b hp2br GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG (–)IRES LDH2s TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA LDH2 CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT LDH2r ... DSLA1 GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG DSLA1 5’341T7 TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT (–)IRES DHp2s TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT Dhp2...

Ngày tải lên: 20/02/2014, 01:20

15 598 0

Báo cáo khoa học: DNA polymerase e associates with the elongating form of RNA polymerase II and nascent transcripts pot

... eukaryotic cells. We describe here a speci c physical interaction between DNA polymerase e and RNA polymerase II, evidenced by reciprocal immunoprecipitation experiments. The interacting RNA polymerase ... interaction is not con- ﬁned to a speci c stage of the cell cycle. This is consis- tent with immunoelectron microscopy, revealing that RNA Pol II and Pol e colocalize thro...

Ngày tải lên: 07/03/2014, 11:20

15 584 0

Báo cáo khoa học: Investigating RNA polymerase II carboxyl-terminal domain (CTD) phosphorylation ˆ Benoıt Palancade and Olivier Bensaude pptx

... 2, 43–53. 43. Rickert, P., Corden, J.L. & Lees, E. (1999) Cyclin C/ CDK8 and cyclin H/CDK7/p36 are biochemically distinct CTD kinases. Oncogene 18, 1093–1102. 3866 B. Palancade and O. Bensaude ... the Association pour la Recherche sur le Cancer (ARC 6250), the Ligue Nationale Contre le Cancer (Comite ´ de Paris) and the Agence Nationale de Recherche sur le SIDA. References 1. Corde...

Ngày tải lên: 17/03/2014, 10:20

12 250 0

Báo cáo Y học: Distinct parts of minichromosome maintenance protein 2 associate with histone H3/H4 and RNA polymerase II holoenzyme pptx

... pGEX-MCM2(169–212) and pFLAG-MCM2(1–230) plasmids was conducted using the Quikchange site-direc- ted mutagenesis kit (Stratagene). 5¢-CCGCTTCAA GAACTTCCCGGGCACTCACGTCAC-3¢ was used as a primer to introduce changes ... at positions 192/193, and 5¢-GCCACGGCCACAACGAG CTCAAGGAGCGCATCAGC-3¢ was used to introduce changes from VF to EL at positions 203/204. Point mutations were conﬁrmed by nucle...

Ngày tải lên: 17/03/2014, 10:20

11 387 0

Báo cáo khoa học: Alizarine derivatives as new dual inhibitors of the HIV-1 reverse transcriptase-associated DNA polymerase and RNase H activities effective also on the RNase H activity of non-nucleoside resistant reverse transcriptases pot

... from Roche (Switzerland). The p12 DNA oligonucleotide (5¢-GTCTTTCTGCTC-3¢), the tC5U RNA oligonucleotide (5¢-CCCCCUCUCAAAAACAGGAGCA GAAAGACAAG-3¢) and the 12mer DNA oligonucleotide F. Esposito ... 0.1 a Compound concentration required to reduce enzyme activity by 50% ± SD. b Compound concentration required to reduce the HIV-1- induced cytopathic effect in MT-2 cells by 50%. c Compound...

Ngày tải lên: 22/03/2014, 16:20

14 425 0

Báo cáo khóa học: Three cyclin-dependent kinases preferentially phosphorylate different parts of the C-terminal domain of the large subunit of RNA polymerase II potx

... characterization of recombinant CDK7/CycH/MAT1, CDK8/CycC and CDK9/CycT1 Earlier studies have provided important information on the substrate preferences of CDK7/CycH/MAT1, CDK8/CycC and CDK9/CycT1. ... modiﬁca- tions and the corresponding enzymes could have additional effects on the substrate speciﬁcities of CDK7/CycH/MAT1, CDK8/CycC and CDK9/CycT1. These effects are beyond the scope...

Ngày tải lên: 23/03/2014, 12:20

11 389 0

Báo cáo khoa học: Aptamers toEscherichia colicore RNA polymerase that sense its interaction with rifampicin, r-subunit and GreB ppt

... transcription cycle, R NAP makes speci c and nonspeci c contacts with double and single stranded (ss) DNA, the RNA/ DNA hybrid and nascent RNA. Recent advances in structural studies of bacterial and ... ssDNA aptamers against Escherichia coli core RNAP. The minimal nucleic acid scaﬀold (an oligonucleotide construct imitating DNA and RNA in elongation complex), rifampicin a...

Ngày tải lên: 23/03/2014, 13:20

11 303 0

Báo cáo khoa học: Mode of action of the microbial metabolite GE23077, a novel potent and selective inhibitor of bacterial RNA polymerase docx

... research, RNAP is currently the subject of renewed interest and excitement, owing to recent publication o f the crystal structures o f t he core [4] and holo [5,6] enzymes, and of an RNAP–DNA complex ... living cells and bacteria, rifampicin is particularly effective against intracellular p athogens, such as Mycobacterium tuberculosis, for which i t is one of the most widely used chem...

Ngày tải lên: 30/03/2014, 15:20

9 339 0

chromatin and chromatin remodeling enzymes, part c

... 279 (2000). 16 chromatin modiﬁcation and remodeling [1] TABLE IV GCN5: ACase Study in Principles of Histone Modification and Function Chromatin-modifier characteristic Gcn5p example 1. Substrate specificity ... 12 f deAc Rpd3 transcriptional repression defect f 17 K12 Ac Hat1 telomeric silencing defect i 38 DNA repair defect 39 K16 Ac Sas2 telomeric and HM silencing defect (40–43) K16 d...

Ngày tải lên: 11/04/2014, 01:19

560 1,1K 0