protein kinase c protocols
protein kinase c protocols
... Newton Protein Kinase C Protocols Edited by Alexandra C. Newton Protein Kinase C Protocols Expression and Purifi cation of PKC from Insect Cells 23 because recombinant viral DNA can be checked before ... each vector can be recovered by conventional plasmid isolation techniques from bacterial culture. Successful recombination effi ciency seems Expression and Purifi cation of PK...
Ngày tải lên: 11/04/2014, 10:12
Tài liệu Báo cáo khoa học: The diacylglycerol and protein kinase C pathways are not involved in insulin signalling in primary rat hepatocytes doc
... hepatocytes with ATP or PLC was speci c for certain molecular species, diacyl, alkylacyl and alk-1-enylacyl subclasses were separated and their molecular species composition was determined by combined ... e) protein kinase C isoforms on insulin-stimulated translocation of epitope-tagged GLUT4 glucose transporters in rat adipocytes: speci c inter- changeable effects of protein kinases...
Ngày tải lên: 20/02/2014, 02:21
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
... Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon -c through the upregulation of protein kinase C in rat vascular smooth muscle cells Kentaro ... a-tocopheryl nicotinate; TRAF, tumor necrosis factor receptor; TS, a-tocopheryl hemisuccinate; VSMC, vascular smooth muscle cells. Enzymes: nitric oxide synthase (EC 1.14.13.39);...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
... pBS-MARCKS 52 nt CU-element plasmid (pBS- MARCKS 52 nt) was constructed by annealing the two synthetic oligonucleotides (sense: 5¢-CCC CGG GCC CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT ... transfection with a chimeric luciferase-MARCKS construct and for transient transfection with the cDNAs coding for human HuD and HuR. The mouse embryonic carcinoma cell line PCC7-Mz1 is a subcl...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khóa học: Phospholipase C, protein kinase C, Ca 2+ /calmodulin-dependent protein kinase II, and redox state are involved in epigallocatechin gallate-induced phospholipase D activation in human astroglioma cells ppt
... characteristic polyphenolic com- pounds epigallocatechin-3-gallate (EGCG), e pigallocate- chin (EGC), epicatechin-3-gallate (ECG) and epicatechin (EC). EGCG is considered to be the constituent primarily responsible ... detected using the enhanced chemiluminescence kit according to the manufacturer’s instructions. Confocal immunofluorescence microscopy U87 cells grown on poly( L -lysine)-coated...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Modulation of the Arabidopsis KAT1 channel by an activator of protein kinase C in Xenopus laevis oocytes potx
... small-conductance cal- cium-activated K + channel, large-conductance Ca 2+ - and voltage-regulated K + channel, hyperpolarization- activated cyclic nucleotide gated channel, ether-a-go-go and cyclic nucleotide-gated ... the cytosolic region of KAT1. Abbreviations AAPK ⁄ ABR kinase, ABA-activated protein kinase ⁄ ABA-responsive kinase; ABA, abscisic acid; CDPK, calcium-dependent protein...
Ngày tải lên: 22/03/2014, 21:21
Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt
... accuaaagca uuaccugccaucaau; ZIP8 #2, ccgauuucaccuucuucaugauuca; ZIP8 #3, ggauuccugucagugacgauuauua; eGFPsi, gcaagcuga cccugaaguucau; PKCa #1, ccaucggauuguucuuucuucauaa; PKCa #2, gccuccauuugauggugaagaugaa; PKCd ... PKCd #1, ccacu acaucaagaaccaugaguuu; and PKCd #2, ccauccacaagaaaugc aucgacaa. PKCe #1, PKCe #2 and PKC siRNAs are the ‘validated Stealth RNAi duo pak’ from Invitrogen (Cergy Pontois...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: Differential involvement of protein kinase C alpha and epsilon in the regulated secretion of soluble amyloid precursor protein docx
... PKC a in carbachol-induced sAPPa release is negligible. The response to carbachol is instead completely blocked in PKCe-deficient cells suggesting the importance o f PKCe in coupling cholinergic ... processing by a-secretase occurs via a constitutive pathway and by receptor-mediated activation of multiple signal trasduction pathways among which protein kinase C (PKC) is a major player. P...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Endogenous mono-ADP-ribosylation mediates smooth muscle cell proliferation and migration via protein kinase N-dependent induction of c-fos expression potx
... oligodeoxynucle- otide primers speci c for GAPDH (sense: 5¢-CGGTGTG AACGGATTTGGCCGTAT-3¢,antisense:5¢-AGCCTTC TCCATGGTGGTGAAGAC-3¢); c- fos (sense: 5¢-GAATA AGATGGCTGCAGCCAAGTGC-3¢,antisense:5¢-AAG GAAGACGTGTAAGCAGTGCAGC-3¢), ... 5¢-GAATA AGATGGCTGCAGCCAAGTGC-3¢,antisense:5¢-AAG GAAGACGTGTAAGCAGTGCAGC-3¢), and c- myc (sense: 5¢-AAGTTGGACAGTGGCAGGGT-3¢,antisense: 5¢-TTGCTCCTCTGCTTGGACAG-3¢)...
Ngày tải lên: 17/03/2014, 09:20
Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt
... (5¢-GTCGAATTCCAAGGTG AAGAACCCCAG-3¢) was located at nucleotides 63–90 of the coding sequence, and the antisense primer (5¢-TG CTGAATTCCCTCCCTCCTGCACTAGTCAG-3¢)over- lapped the stop codon. DNA sequencing confirmed the restored ... hepatocellular carcinoma (HCC) [1] and in the pancreas during acute pancreatitis [2]. HIP/ PAP has been characterized as a protein belonging to the group 7 of C- t...
Ngày tải lên: 23/03/2014, 13:20