g a constantinides - synthesis and optimization of dsp algorithms - 2004

... DSP algorithms is the computational throughput achievable. Many DSP algorithms are highly parallelizable, and could benefit significantly from more fine-grain parallelism than that available with gen- eral ... lead to low signal-to-noise ratio. To determine an appropriate scaling, it is necessary to determine the peak value that each signal could reach. Given a peak value P , a pow...

Ngày tải lên: 09/04/2014, 16:39

... goal we synthesized a novel mitochondria-targeted DNA- alkylating reagent. The active alkylating moiety [(11aS )-8 - hydroxy-7-methoxy-1,2,3,1 1a- tetrahydro-5H-pyrrolo[2,1-c] [1,4]benzodiazepin-5-one ... James et al. (Eur. J. Biochem. 270) Ó FEBS 2003 Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [ 4-( (11aS )-7 -methoxy-1...

Ngày tải lên: 20/02/2014, 11:20

... Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table 1). Glycine, which is not a substrate of peptide transporters, did ... 5 Bip-Pro 14 ± 1 Ala-Ala 15 ± 1 Pro-Ala 105 ± 3 Lys-Lys 46 ± 2 Ala-Asp 19 ± 1 D-Phe-Ala 65 ± 2 Ala-Ala-Ala 21 ± 1 d-Aminolevulinic acid 78 ± 3 Cefadroxil 15 ± 1 Lys[Z(NO 2 )]-Val 10...

Ngày tải lên: 07/03/2014, 05:20

... 2003 recognition and blockage of rat Kv1.2 channels Fig. 8A, B). These maps suggest an important contribution of Arg10, Arg19, Lys26, Ile28, Lys30, Lys33 and Tyr35 residues for Pi4, as well as of Arg5, ... are highlighted in gray boxes and numbered from N- to C-terminus. The asterisk indicates a C-terminal carboxylami- dated extremity. Fig. 2. Analytical C 18 reverse-phase HPLC...

Ngày tải lên: 17/03/2014, 10:20

... Fiorani D, Testa AM (2001) Investigation of mag- netic properties of interacting Fe 2 O 3 nanoparticles. J Magn Magn Mater 224:5–11 J Nanopart Res 123 RESEARCH PAPER Synthesis and growth of hematite ... that each of the large particles (outer diameter *1 lm and thickness *250 nm) was made up of many small plate-like particles. Chen and Gao (2004) also suggested that the pre...

Ngày tải lên: 20/03/2014, 13:08

... -Oil and mineral prospecting -Process monitoring & control -Nondestructive testing -CAD and design tools -Radar -Sonar -Ordnance guidance -Secure communication -Voice and data compression -Echo ... intercontinental communications, and is particularly objectionable. Digital Signal Processing attacks this type of problem by measuring the returned signal and generating an approp...

Ngày tải lên: 13/09/2012, 09:49

... management approaches, he was managed conserva- tively and was healthy on a follow-up. Figure 1. Neuroimaging of the twins. (a) Cerebral CT of twin A shows a vast lesion of cerebrospinal ... suggested that late splitting of the egg may play a role in twins with op- posite handedness and cerebral dominance. Fur- thermore, a pair of identical twins with mir- ror-i...

Ngày tải lên: 25/10/2012, 11:00

... by integration of the multi-phase CFD simulator TOUGH2 with a genetic algorithm (GA) optimizer, designated as GA-TOUGH2. This paper presents the application of GA-TOUGH2 on two optimization ... (a) design of an optimal water-alternating-gas (WAG) injection scheme for a vertical injector in a generic aquifer and (b) the design of an optimal injection pressure management s...

Ngày tải lên: 05/09/2013, 16:10

... the autocoding toolset as PGM application data flow graphs along with a candidate architectures file and graph partition lists. The lists are generated by hardware/software partitioning tools. The ... Conference on Acoustics, Speech, and Signal Processing, pp. 123 2-1 235, Atlanta, GA. May 7-1 0, 1996. [19] Frank, G. A. , Armstrong, J.R., and Gray, F .G. , Support for model-year u...

Ngày tải lên: 25/12/2013, 06:16

... of the human c-fos promoter, and RHN(CH 2 ) 6 - CATTTCCCTTAAATCGAAGATTTAAG GGAAATG-(CH 2 ) 3 NHR (mutated hairpin control ODN) (Sigma-Proligo; Sigma-Aldrich Corp., St Louis, MO, USA), where R ... participates in growth regulation of human breast carcinoma cells. Oncogene 20, 2499–2513. 9 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu T, Ue...

Ngày tải lên: 18/02/2014, 08:20