Báo cáo khoa học: "Optimization in Coreference Resolution Is Not Needed: A Nearly-Optimal Algorithm with Intensional Constraints" ppt

... within their clauses (the main and the subordinate clause, respectively). A pairwise classifier could learn this given appropriate features or, alternatively, bind- ing constraints could act as ... mean. We have adapted Balas’ algorithm to the special needs of coreference resolution. First and fore- most, this results in an optimization algorithm that treats global constraints inten...

Ngày tải lên: 31/03/2014, 20:20

... Zoubin Ghahramani, and Carl Ed- ward Rasmussen. 2002. The In nite Hidden Markov Model. In Advances in Neural Information Processing Systems 14 (NIPS). Cosmin Adrian Bejan and Sanda H a rabagiu. ... Coreference Resolution with Rich Linguistic Features Cosmin Adrian Bejan Institute for Creative Technologies University of Southern California Marina del Rey, CA 90292, USA Sanda Harab...

Ngày tải lên: 07/03/2014, 22:20

... conversation. It is important to have a mechanism that supports competition and ranking among these constraints to achieve an optimal interpretation, in particular, a mechanism to allow constraint ... constraints as soft, which means violable and conflicting. The interpretation that arises for an utterance within a certain context maximizes the degree of constraint satisfacti...

Ngày tải lên: 17/03/2014, 06:20

... an example, assume L contains the following entries: (beeta-agonistit, adren- ergic beta-agonists), (beetasalpaajat, adrenergic beta-antagonists) and (alfa-agonistit, adrener- gic alpha-agonists). ... We might translate the Finnish term alfasalpaajat into the English term adrenergic alpha-antagonists by 1) identifying the input triplet: (beeta-agonistit, beetasalpaa- jat, alfa-agonistit) ; 2)...

Ngày tải lên: 31/03/2014, 20:20

... in an alga [1] (Laminaria japonica), a fungus [2] (Volvariella volvacea) and bacteria [3] (Shiga and Shiga- like toxins). They are divided into three main groups. Type 1 RIPs are single-chain ... proteins with N-b-glycosidase activity. Type 2 RIPs are larger proteins consisting of two distinct chains: an A- chain (with the same enzymatic activity as type 1 RIPs) that is linked by a...

Ngày tải lên: 30/03/2014, 13:20

... structure with an asymmetric structural motif in a linked gA derivative. Mini-gA (11 amino- acid residues, denoted as chain A) and gA (15 resi- dues, denoted as chain B) are linked head-to-head by ... structural motif: asymmetric with similarity in chains A and B (chain B ¼ Val-Gly-Ala-d-Leu-chainA; Fig. 1). As a result, all the amino-acid residues are in different chemical e...

Ngày tải lên: 30/03/2014, 15:20

... data. A comparison of the performance of the systems when part-of-speech is used against a baseline sys- Table 4: Comparison of using an “ASR stop-list” and “enhanced preprocessing” for handling ... segmentation with probabilistic latent semantic analysis. In Inter- national Conference on Information and Knowledge Management (CIKM), McLean, VA. Jaime Carbonell, Yiming Yang, Ralf Bro...

Ngày tải lên: 31/03/2014, 03:20

... (2004)). We argue that providing a resolver with the an- notated CEs is a rather unrealistic evaluation: de- termining whether an NP is part of an annotated coreference chain is precisely the job of a ... the “anaphoric” ex- tracted CEs, i.e. the extracted CEs that have an annotated twin that is not a singleton. Note that for the MUC datasets all extracted CEs that have...

Ngày tải lên: 30/03/2014, 23:20

... protease gene was isolated by PCR with the upstream primer GAACA TATGGCCGATAGACAAGGAACTGTATCC and the downstream primer AGGGGATCCCTAAAAATTTAA AGTGCAACCAATCTG. The annealing site for the upstream ... A ˚ ) and had van der Waals interaction with Cb of Ala28 (Ala128) at a distance of 3.9 A ˚ .Thesame arrangement has been observed for other C2-symmmertric diol-containing inhibitors [40]...

Ngày tải lên: 08/03/2014, 02:20

... continuously increas- ing efforts in the construction of parse-annotated corpora. Substantial treebanks 2 are now available for many languages (including English, Japanese, Chinese, German, French, ... f-structure annotations are passed to a con- straint solver to produce f-structures. Annotation is evaluated in terms of coverage and quality, sum- marised in Table 1. Coverage is n...

Ngày tải lên: 08/03/2014, 04:22