Báo cáo khoa học: "INCORPORATING INHERITANCE AND FEATURE STRUCTURES INTO A LOGIC GRAMMAR FORMALISM" pptx

... treated as a context-free grammar rule and the interpreter automatically appends two additional arguments (start and end) to facilitate parsing. The final syntactic sugar allows feature labels ... Its taxo- nomic reasoning facilitates semantic type-class reasoning during grammatical analysis. INTRODUCTION The Inheritance Grammar (IG) formalism is an extension of Hassan Ait-Kaci's ... accommodated naturally. OTHER GRAMMATICAL APPLICATIONS OF TAXONOMIC REASONING The taxonomic reasoning mechanism of IG has applications in lexical and syntactic categorization as well as in semantic...

Báo cáo khoa học: "PROSODIC INHERITANCE AND MORPHOLOGICAL GENERALISATIONS" pot

... vi taqaatal vi ataqaatal vii nqatal vii anqatil viii q t a t a I viii a q t a t i I ix qtalal ix aqtalil x staqtal x astaqtil xi qtaalal xi aqtaalil xii qtawtal xii aqtawtil xlii qtawwal ... act surf orth roman> = Qth <imperf act surf orth roman> = i qatal i aqtul-*aqatil ii qattal ii uqattil iii q a at a I iii u q a at i I iv ?aqtal iv u?aqtil v taqattal v ataqattal ... mutaqattal vi mutaqaatal vii munqatal viii m u q t a t a I ix *muqtalal x mustaqtal xi *muqtaalal xii *muqtawtal xiii *muqtawwal xiv *muqtanlal xv *muqtanlay. Dhrj: <part act surf...

Tài liệu Báo cáo khoa học: Puriﬁcation and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... NatlAcad Sci USA 102, 4235–4239.33 Shikata Y, Watanabe T, Teramoto T, Inoue A, Kawakami Y, Nishizawa Y, Katayama K & KuwadaM (1995) Isolation and characterization of a peptideisomerase ... 275–283.10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K,Watanabe T, Kawai T, Kawakami Y, Niidome T,Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin-TK containing D-serine at position 46, but ... China Sea. Sephadex G-25 was purchased fromAmersham Biosciences (Uppsala, Sweden), a ZORBAX300SB-C18 semipreparative column was from Agilent Tech-nologies (Santa Clara, CA, USA), and triﬂuoroacetic...

Tài liệu Báo cáo khoa học: Puriﬁcation and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

... CTGATCTAGAGGTACCGGATCC5RACF ATCCTCACGAACAAGCAG5RACR GATCGCGATGCAGGCCTTFLF1 GGACGACTACAGCGTCTTCAGTAGAFLR1 TCCAAACAGTCAGTTTCTTAACCGTTable 1. Puriﬁcation of cellulase from abalone Haliotis discus hannai. ... each row. The translational start codon ATG, termination codon TAA, and a putative polyadenylation signal AATAAA are boxed. A putative signal peptide is indicated by a dotted underline. The amino-acid ... fraction V as a standard protein.cDNA cloningConstruction of the cDNA library and cloning of cellulasecDNA was achieved as follows: Total RNA was extractedfrom 1 g of abalone hepatopancreas...

Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

... Physicochemical characterization and biological activityof a glycoglycerolipid fromMycoplasma fermentansKlaus Brandenburg1, Frauke Wagner1, Mareike Mu¨ ller1, Holger Heine1,Jo¨ rg Andra¨1, ... i.e. agonistically as wellas antagonistically, completely inactive. The lack ofantagonistic activity may be explained by the fact thatthis lipid A does not intercalate into target cell membranesby ... Chicester.32. Mu¨hlradt, P.F. & Frisch, M. (1994) Puriﬁcation and partial bio-chemical characterization of a Mycoplasma fermentans-derivedsubstance that activates macrophages to release nitric oxide,tumor...

Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf

... L, Hamid Q & Elias JA (2004) Acidicmammalian chitinase in asthmatic Th2 inﬂammation and IL-13 pathway activation. Science 304, 1678–1682.4 Kasprzewska A (2003) Plant chitinases ) regulation ... chitinasesfrom Burkholderia gladioli, Vibrio cholerae, Haemophi-lus inﬂuenzae, and Pseudomonas aeruginosa. Althoughmany plant family 19 chitinases are known, crystal structures are available ... domains that are at least as large asthose of the plant enzymes and that may contain atleast six subsites [26,30]. However, the catalyticdomains of ChiG, ChiC and most other known bacter-ial...

Báo cáo khoa học: New human and mouse microRNA genes found by homology search pptx

... exons generating stableRNA products. Nature 379, 464–466.36 Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M,Marks D, Snyder B, Gaasterland T, Meyer J &Tuschl T (2003) The small RNA proﬁle ... two parts, located on chr5_random (aa 133–538) and chr5 (aa539–1529). Mmu-mir-218–1 resides in the chr5_random part.chsa-mir-103–2 and mir-103–1 are closely related to hsa-mir-107 (87 and ... polyA tails of theBC064349 mRNA and of several ESTs (Fig. 2B).These data thus strongly suggest that hsa-let-7d, and possibly hsa-let-7f-1 and hsa-let- 7a- 1, are part ofan intronless transcript...

Báo cáo khoa học: Identiﬁcation and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

... HepG2cDNA library (C. Baisez and A. Harduin-Lepers, unpublished data), as the template and two speciﬁc primers For 6I 5¢-CGATGAATTCGTTAACGCTCATCACCATCACCATCACGGGAAATTGGCCATGGGGT-3¢ containing a HpaIsiteandBack6I ... kidney,thymus, liver), and rather weakly in placenta, lung, aorta,amygdala, occipital and parietal lobe and salivary gland.Almost no expression was observed in fetal lung and heart,uterus, bladder, kidney, ... the annealingof the two following synthetic oligonucleotides For EGT 5¢-GATCCGCCACCATGACCATCTTATGTTGGCTCGCTCTCCTGAGCACACTCACAGCTGTTAACGCTGACATCA-3¢ and Back EGT 5¢-GATCTGATGTCAGCGTTAACAGCTGTGAGTGTGCTCAGGAGAGCGAGCCAACATAAGATGGTCATGGTGGCG-3¢....

Báo cáo khoa học: Identiﬁcation and functional characterization of a novel barnacle cement protein pptx

... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKABacp19k VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSLBicp19k AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV130 ... GVTGGGASVSTTSATQGSG, GFSEGTAAISQTAGANGGATV, and Fig. 1. Mrcp-19k from M. rosa cement and its bacterial recombi-nant analyzed by SDS ⁄ PAGE. Lanes 1 and 2: GSF1 and GSF2 pre-pared from M. rosa ... Industries(Osaka, Japan) and Takara Shuzo Co. (Otsu, Japan). Two-fold-concentrated ASW was prepared by dissolving ASW(Senju Seiyaku Co., Osaka, Japan) in ultrapure water,which was ultraﬁltered...

Báo cáo khoa học: Ligand binding and antigenic properties of a human neonatal Fc receptor with mutation of two unpaired cysteine residues docx

... a heavychain (HC) with three ectodomains (a1 , a2 and a3 ), a transmembrane part and a short intracellular signalingtail. Like MHC class I HC, the FcRn counterpart isnoncovalently associated ... human FcRn. The structural and func-tional integrity was proved by CD, surface plasmon resonance and MALDI-TOF peptide mapping analyses. The strategy may generally betranslated to the large-scale ... vicinal cysteines251 and 252. The ion at m ⁄ z 2332.06(Fig. 4C) was selected for fragmentation, and observed y-, b- and a- fragment ions areindicated. For an easier illustration observedy- and...

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Thơ nôm tứ tuyệt trào phúng hồ xuân hương Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ