UNDERSTANDING FISHERIES MANAGEMENT: A Manual for understanding the Federal Fisheries Management Process, Including Analysis of the 1996 Sustainable Fisheries Act doc
... determining the spawning stock biomass. Year class UNDERSTANDING FISHERIES MANAGEMENT: A Manual for understanding the Federal Fisheries Management Process, Including Analysis of the 1996 Sustainable Fisheries ... meet in their management of federal fisheries. Note that the provisions of the Sustainable Fisheries Act that called for...
Ngày tải lên: 31/03/2014, 13:20
... those aren’t the actual cause of your procrastination - the cause is fear - but they are the activities we turn to when we are afraid, and they serve to distract us from both the fear, and the ... Procrastination, which is usually caused by a lack of information or training, Fear-Based Procrastination is caused by, as its name implies, fear. Fear is unfortunately a major...
Ngày tải lên: 21/02/2014, 22:20
...
Ngày tải lên: 07/03/2014, 02:20
Tài liệu TUBERCULOSIS - A Manual for Medical Students ppt
... implement a programme The success of a programme depends on the implementation of a number of activities: • Preparation of a programme manual which sets out the technical and operational measures of the ... 45,African-Americans, Hispanics and immigrants from Asia and the Pacific .The overall increase in the USA was halted in 1993. This increase in notification r...
Ngày tải lên: 15/02/2014, 13:20
Tài liệu Business Ethics: A MANUAL FOR MANAGING A RESPONSIBLE BUSINESS ENTERPRISE IN EMERGING MARKET ECONOMIES pptx
... The CEO is the board’s only official link to operational achievement and conduct, so that all au- thority and accountability of management is considered by the board to be the authority and accountability ... the owners, what about the many other considerations of the RBE, such as other stakeholders, the rule of law, and ethical conduct? These are means issues. They ar...
Ngày tải lên: 18/02/2014, 00:20
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... Seligman PA & Allen RH (1978) Characterization of the receptor for transcobalamin II isolated from human placenta. J Biol Chem 253, 1766–1772. 22 Quadros EV, Nakayama Y & Sequeira JM (2005) ... 4753 Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor Sergey N. Fe...
Ngày tải lên: 19/02/2014, 05:20
Báo cáo khoa học: Analysis of the NADH-dependent retinaldehyde reductase activity of amphioxus retinol dehydrogenase enzymes enhances our understanding of the evolution of the retinol dehydrogenase family pot
... peak areas with a calibration curve constructed from peak areas of a series of standards. The peak detection limit was about 2 pmol of retinoid. The apparent K m values for the reduction of all-trans-ret- inal ... of all-trans-retinaldehyde using NADH as cofactor, a remarkable com- bination of substrate and cofactor preferences. Moreover, evolutionary analysis, inc...
Ngày tải lên: 07/03/2014, 09:20
Surviving Health Care A Manual for Patients and Their Families potx
... Palliative Care in the Department of Medicine at the Alameda County Health Center, Oakland, California. Alexis Lopez, BA , is a Research Technician with the Program in Medicine and Human Values, California ... Assistant Professor of Medicine at the Indiana University Medical Center, and Assistant Professor of Philosophy at the Indiana University School of Liberal Arts at I...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf
... Edmonton, AB, Canada Type IIa bacteriocins, which are isolated from lactic acid bacteria that are useful for food preservation, are potent antimicrobial peptides with considerable potential as therapeutic ... than the mature peptide [14]. To help determine the structural basis of the inhibition of the antimicrobial activity of CbnB2 by the leader and to assist future analys...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
... 5¢-CG GGATCCCAATCTGTTGCTAA TTAGG-3¢)andthe3¢ specific oligonucleotides (5¢-GA AGATCTACCACACCTCCTCATCTCC-3¢) for ampli- fication of the region from )180 to )36 and (5¢-GA AGAT CTAACTAGATTTTACCATTGG-3¢) for amplification of the ... sequence analysis of the 35-bp region identified a DNA motif identical to the consensus DNA binding site (GGAAAA [37]), for a family of calci...
Ngày tải lên: 08/03/2014, 10:20