Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

... D16W-D 24) 37 GGN4, a GGN4 analogue with both the C-terminal 14 residue truncation and the substitution of the aspartic acid at position 16 by tryptophan, showed antimicrobial activity comparable to that of native ... single tryptophanyl substitution to increase the antimicrobial activity of the C-terminally truncated GGN4. In addition, in this work, t...

Ngày tải lên: 31/03/2014, 09:20

8 448 0
Tài liệu Báo cáo khoa học: Cold survival in freeze-intolerant insects The structure and function of b-helical antifreeze proteins pdf

Tài liệu Báo cáo khoa học: Cold survival in freeze-intolerant insects The structure and function of b-helical antifreeze proteins pdf

... describe the structure and dynamics of each protein, and present a comparison of s bwAFP and TmAFPwitheachotherandwithproteinsthathavea similar fold. Structure of sbwAFP and TmAFP The structure of ... in activity Examination of the crystal structures of the insect AFPs also revealed the presence of an array of water molecules Fig. 4. Comparison of...

Ngày tải lên: 19/02/2014, 16:20

12 717 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... lysate and the periplasmic fraction, but was absent from the membrane and cytoplasmic fractions. (B) The same cell fractions as shown in (A) when sub- jected to SDS ⁄ PAGE analysis and stained ... investigate its role by mak- ing use of the generation and characterization of an unmarked deletion in nirF. The unmarked gene deletion mutant is expected to lose nitrite respi...

Ngày tải lên: 15/02/2014, 01:20

12 614 0
Tài liệu Báo cáo khoa học: "Generating with a Grammar Based on Tree Descriptions: a Constraint-Based Approach" pptx

Tài liệu Báo cáo khoa học: "Generating with a Grammar Based on Tree Descriptions: a Constraint-Based Approach" pptx

... with the more traditional generative approach usually pursued in tactical generation and further, that the combination of this static view with a TAG-like grammar and a flat semantics results in a ... grammars is initiallytheoretical: the use of logic should sup- port both a more precise formulation of grammars and a different perspective on the mathematical an...

Ngày tải lên: 20/02/2014, 18:20

8 397 0
Tài liệu Báo cáo khoa học: "From HOPE en I''''ESPERANCE On the Role of Computational Neurolinguistics in Cross-Language Studies " pptx

Tài liệu Báo cáo khoa học: "From HOPE en I''''ESPERANCE On the Role of Computational Neurolinguistics in Cross-Language Studies " pptx

... fically in agrammatics and Broca's aphasics. French neurolinguistic studies have documented a similar degradation in the ability of agrammatic and Broca's aphasics (LeCours and Lhermitte, ... HOPE HOPE is not an acronym but was chosen as the name of the system based on the legend of Pandora's box. While raising many questions of language within...

Ngày tải lên: 21/02/2014, 20:20

5 610 0
Tài liệu Báo cáo khoa học: "Language Resources Factory: case study on the acquisition of Translation Memories" potx

Tài liệu Báo cáo khoa học: "Language Resources Factory: case study on the acquisition of Translation Memories" potx

... Soaplab Soaplab (Senger et al., 2003) 2 allows a WSP to deploy a command line tool as a WS just by writ- ing a metadata file that describes the parameters of the tool. Soaplab takes care of the ... format. On the other hand, GrAF can be used as a pivot format between other for- mats (Ide and Bunt, 2010), e.g. there is software to convert GrAF to UIMA and GATE format...

Ngày tải lên: 22/02/2014, 03:20

5 532 0
Báo cáo khoa học: Betulinic acid-mediated inhibitory effect on hepatitis B virus by suppression of manganese superoxide dismutase expression pot

Báo cáo khoa học: Betulinic acid-mediated inhibitory effect on hepatitis B virus by suppression of manganese superoxide dismutase expression pot

... Kanazawa Y & Hayashi N (2006) Viral covalently closed circular DNA in a non- transgenic mouse model for chronic hepatitis B virus replication. J Hepatol 44 , 267–2 74. 46 Hathaway CA, Heistad ... counter and was normalized to protein concentration. Reverse transcription reaction and real-time PCR Total RNA from treated cells was extracted with an RNeasy Mini Kit (Qiagen, Shanghai,...

Ngày tải lên: 16/03/2014, 01:20

16 352 0
Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx

Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx

... cata ag ATGTCC 3.8 10 9 94 AAGGAC gt aagt … ttaa ag GATTGC 0.70 11 176 AGAAGA gt aagt … ttgc ag CAATTT 5 .4 12 130 ATGTTG gt aagt … tttt ag GGCATA 6.3 13 85 ACTCAA gt aaga … tatc ag GATTTC 4. 2 14 51 ... 4. 2 14 51 AAGTAG gt aagt … attt ag CTTGCA 3.2 15 259 CAAAAG gt aaga … tctt ag ATTGGT 4. 7 16 > 640 a Some ESTs (e.g. accession AL 549 015) lack part of exon 4; a few ESTs...

Ngày tải lên: 23/03/2014, 13:20

9 470 0
Báo cáo khoa học: "Last but Definitely not Least: On the Role of the Last Sentence in Automatic Polarity-Classification" pdf

Báo cáo khoa học: "Last but Definitely not Least: On the Role of the Last Sentence in Automatic Polarity-Classification" pdf

... evaluation at all. Such an addition would have necessitated locating the extra- choice radio button at a separated remote place from the 5-star scale radio buttons, since concep- tually it cannot ... was run in an individual session and had an unlimited time to reflect and decide on the polarity of each text. Five seconds after a decision was made (as to whether the...

Ngày tải lên: 23/03/2014, 16:20

5 356 0
Báo cáo khoa học: Nop53p interacts with 5.8S rRNA co-transcriptionally, and regulates processing of pre-rRNA by the exosome ppt

Báo cáo khoa học: Nop53p interacts with 5.8S rRNA co-transcriptionally, and regulates processing of pre-rRNA by the exosome ppt

... TGTTGGAGCACAAGCAAG This study SnR74For GCTGCAGAAGATGAAACAA This study SnR74Rev GCATCAGACACTAATTGC This study Cr.V interg. For GGAAATGCGTAGGGAAGACCA ATTTCATGACG This study Cr.V interg. Rev GATGCCTCTTTAGAACAAGGTT ACAAATCCTG This ... Buratowski Moore CL & Greenblatt J (2003) Organization and function of APT, a sub-com- plex of the yeast cleavage and polyadenylation factor involve...

Ngày tải lên: 30/03/2014, 04:20

15 380 0
w