Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc
... Ophthalmol. Vis. Sci. 39, 315–321.Ó FEBS 2002 Analysis of < /b> the < /b> TPa and < /b> TPb mRNAs (Eur. J. Biochem. 269) 4073 Characterization < /b> of < /b> the < /b> 5¢ < /b> untranslated < /b> region < /b> of < /b> a < /b> and < /b> b isoforms of < /b> the < /b> human thromboxane ... the < /b> human thromboxane A< /b> 2 receptor (TP) alpha and < /b> beta isoforms. Biochim. Biophys. Acta. 1425, 543–559.18. Habib, A.< /b> , FitzGerald, G .A.< /b> & Maclouf, J. (1999) Phosphoryla-tion of < /b> the < /b> thromboxane ... Dublin, IrelandIn humans, thromboxane (TX) A< /b> 2signals through twoTXA2 receptor (TP) isoforms, TPa and < /b> TPb,thatdivergewithin their carboxyl terminal cytoplasmic (C) tail regions and < /b> arise by differential...
- 16
- 321
- 0
Báo cáo khoa học: Nop53p interacts with 5.8S rRNA co-transcriptionally, and regulates processing of pre-rRNA by the exosome ppt
... study18SRevPE AATTCAGGGAGGTAGTGACA [26]SnR37For CCGATTGGCAAAAAC This studySnR37Rev TGTTGGAGCACAAGCAAG This studySnR74For GCTGCAGAAGATGAAACAA This studySnR74Rev GCATCAGACACTAATTGC This studyCr.V ... GGAAATGCGTAGGGAAGACCAATTTCATGACGThis studyCr.V interg. Rev GATGCCTCTTTAGAACAAGGTTACAAATCCTGThis study5.8SFor2865 CTTTCAACAACGGATCTCTTGG [31]5S GGTCACCCACTACACTACTCGG [31]scR1Rev TCTAGCCGCGAGGAAGGA ... Sandro R. Valentini (UNESP,Araraquara, Brazil) for anti-Nip7p and < /b> anti-Rpl5p anti-sera, respectively. We also thank Beatriz A.< /b> Castilho(UNESP, Sa˜o Paulo, Brazil) and < /b> Daniel C. Pimenta(Butantan...
- 15
- 380
- 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... collection of < /b> the< /b> data in and < /b> of < /b> itself as the < /b> basis for taking relevant actionat the < /b> farm. They may skip the < /b> process of < /b> systematic anal-ysis of < /b> data and < /b> give advice based on their immediate eval-uation ... phenomena; 'scoring and< /b> recording data on metritis' that relate to the < /b> quality of < /b> the< /b> data that are produced. We analyse and < /b> build &apos ;a < /b> model of< /b> understanding' based on DBL's ... suggest that the < /b> importance of < /b> the < /b> epi-demiological aspects on data quality of < /b> field data shouldbe articulated and < /b> emphasised in the < /b> education of < /b> veteri-narians, both at student and < /b> post-graduate...
- 10
- 587
- 0
Báo cáo khoa học: "Hedge classification in biomedical texts with a weakly supervised selection of keywords" doc
... Probabilistic training data acquisitionTo build our classifier models, we used the < /b> datasetgathered and < /b> made available by (Medlock and< /b> Briscoe, 2007). They commenced with the < /b> seed setSspecgathered ... with a < /b> sim-ilar class-conditional probability on the < /b> specu-lative class (worse by 2% at most). Here wediscarded a < /b> further 30% of < /b> the < /b> candidates and< /b> kept 253 uni-, bi-, and < /b> trigrams altogether.This ... way of < /b> reranking and < /b> selecting po-tentially relevant features (we managed to discard89.5% of < /b> all the < /b> initial candidates automatically)made it easier for us to manually validate the < /b> re-maining...
- 9
- 407
- 0
Báo cáo khoa học: DYRK1A phosphorylates caspase 9 at an inhibitory site and is potently inhibited in human cells by harmine pptx
... duplexes: 5¢-< /b> GAAAUUGACUCGCUCAUUGrUrU-3¢ ,5¢-< /b> ACACGGAGAUGAAGUACUArUrU-3¢ ,5¢-< /b> GCCAGAGGAUCUACCAGUArUrU-3¢ ,5¢-< /b> GCACAUCAAUGAGGUAUACrUrU-3¢. Single siRNA duplexes were synthesized by MWG(Martinsried, Germany).Caspase ... initiates a < /b> proteolyticcascade by processing and < /b> activating downstreameffector caspases such as caspase 3 and < /b> caspase 7, lead-ing to the < /b> organized disassembly of < /b> the < /b> cell [11].Regulation of < /b> apoptosome ... containing the < /b> catalytically inactivating C28 7A < /b> mutation)was incubated with recombinant DYRK 1A < /b> in the < /b> presence of < /b> [32P]ATP[cP] as indicated. Samples were analysed by SDS ⁄ PAGE, followed by autoradiography....
- 13
- 317
- 0
Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx
... QaCgClp1 (5¢-< /b> CCATGAAGTCCGCGAATC-3¢); and< /b> QsCgClp2 (5¢-< /b> GCATAGCGATGTGGACGA-3¢) and< /b> QaCgClp2 (5¢-< /b> GAGGACCGAGACCGTGAA-3¢). The< /b> abbreviations ‘Qs’ and < /b> ‘Qa’ refer, respectively, to sense and< /b> antisense ... primers. Accurate amplification of < /b> the < /b> targetamplicon was checked by obtaining a < /b> melting curve.Using QsGAPDH (5¢-< /b> TTCTCTTGCCCCTCTTGC-3¢) and< /b> QaGAPDH (5¢-< /b> CGCCCAATCCTTGTTGCTT-3¢), a < /b> paral-lel amplification ... cytokininhomeostasis in tobacco. Plant Mol Biol 53, 877–890.7 Kawamura K, Shibata T, Saget O, Peel D & Bryant PJ(1999) A < /b> new family of < /b> growth factors produced by the< /b> fat body and < /b> active on Drosophila...
- 9
- 584
- 0
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt
... (Promega),followed by assay of < /b> DNase I and < /b> b- galactosidase activities,according to a < /b> previously described method [32].Preparation of < /b> nuclear extracts and < /b> EMSA The < /b> nuclear extract and < /b> probe were prepared as reportedpreviously ... the < /b> totalRNA from QGP-1 cells and < /b> a < /b> primer set of < /b> the < /b> forward pri-mer DN-5R and < /b> the < /b> reverse primer DN+854X (sequences 5¢-< /b> CGGAATTCTCAGGATGAGGGGCATGAAG-3¢ and < /b> 5¢-< /b> CGCTCGAGGCTGCTCACTTCAGCATCAC-3¢, ... generate a < /b> calibration curve. The < /b> plas-mid templates were measured using a < /b> spectrophotometer, and < /b> copy numbers were calculated from the < /b> absorbance at260-nm. For each assay, a < /b> standard curve was...
- 12
- 609
- 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc
... Characterization < /b> of < /b> the < /b> interaction between the < /b> plasmamembrane H+-ATPase of < /b> Arabidopsis thaliana and < /b> a < /b> novelinteractor (PPI1)Corrado Viotti, Laura Luoni, Piero Morandini and < /b> Maria Ida ... novel interactor of < /b> the < /b> C-ter-minus of < /b> Arabidopsis thaliana plasma membrane H+-ATPase (EC 3.6.3.6)(Morandini P, Valera M, Albumi C, Bonza MC, Giacometti S, Ravera G,Murgia I, Soave C & De ... slightly increasedVmaxbut substantially lowered the < /b> apparent KmforMgATP.Activation of < /b> the < /b> PM H+-ATPase by cleavage or by displacement of < /b> the < /b> auto-inhibitory C-terminal domainis strongly pH-dependent,...
- 8
- 629
- 0
Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx
... 5¢-< /b> TATGGATCCTTAATTAGAAACAAACTGTCTGATAAACP2OH 5¢-< /b> CTCGAGATTAGAAACAAACTGTCTGATAAACCP1Z 5¢-< /b> ATACCATGGCTGGAGAAGACTTTAAGATCP1ZH 5¢-< /b> CATATGACTGGAGACTTTAAGATCP2Z 5¢-< /b> TATGGATCCTCACCACCCAATTTCGGAAAGP2ZH 5¢-< /b> CTCGAGCCACCCAATTTCGGAAAGTTable ... and < /b> His-tag, respectively.Underlined are the < /b> restriction enzyme sites.Primer SequenceP1O 5¢-< /b> ATACCATGGACAAAACCCACAGTACAATGP1OH 5¢-< /b> CATATGCACAAAACCCACAGTACP2O 5¢-< /b> TATGGATCCTTAATTAGAAACAAACTGTCTGATAAACP2OH ... the < /b> absorbance of< /b> the < /b> supernatant was read at 363 nm. The < /b> absorbance of< /b> the < /b> reduced form of < /b> APAD (APADH) was linear over the< /b> 2–100 lMrange of < /b> glutamate with a < /b> molar extinctioncoefficient of...
- 8
- 649
- 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... receptor (TP) alpha and < /b> beta isoforms. Bio-chim Biophys Acta 1425, 543–559.25 Coyle AT, Miggin SM & Kinsella BT (2002) Characteri-zation of < /b> the < /b> 5¢ < /b> untranslated < /b> region < /b> of < /b> alpha and < /b> beta isoforms ... pGL 3b: Prm 3a< /b> AP)1*, pGL3e:Prm 3a< /b> AP)1*,pGL 3b: Prm3abAP)1*, pGL3e: Prm3abAP)1*, pGL 3b: Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL 3b: Prm3aaaAP)1* and < /b> pGL3e:Prm3aaaAP)1*.Mutation of < /b> the < /b> Oct-1 ... December2004)doi:10.1111/j.1742-4658.2004.04538.x The < /b> TPa and < /b> TPb isoforms of < /b> the < /b> human thromboxane A< /b> 2 receptor (TP) arise by differential splicing but are under the < /b> transcriptional control of< /b> two distinct promoters, termed Prm1 and < /b> Prm3,...
- 18
- 509
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ