Báo cáo khoa học: Activated transglutaminase from Streptomyces mobaraensis is processed by a tripeptidyl aminopeptidase in the final step pptx

Báo cáo khoa học: Activated transglutaminase from Streptomyces mobaraensis is processed by a tripeptidyl aminopeptidase in the final step pptx

Báo cáo khoa học: Activated transglutaminase from Streptomyces mobaraensis is processed by a tripeptidyl aminopeptidase in the final step pptx

... with the tetrapeptide Ala-Ala-Val-Ala-pNA was revealed. The inability of the peptidase to hydrolyse Ala-Ala-pNA and Ala-pNA (or other chromogenic amino acids) at reason- able rates clearly indicates ... Activated transglutaminase from Streptomyces mobaraensis is processed by a tripeptidyl aminopeptidase in the final step Jens Zotzel*, Ralf Pasternack*, Chr...
Ngày tải lên : 31/03/2014, 07:20
  • 7
  • 480
  • 0
Tài liệu Báo cáo khoa học: NMR structural characterization of HIV-1 virus protein U cytoplasmic domain in the presence of dodecylphosphatidylcholine micelles doc

Tài liệu Báo cáo khoa học: NMR structural characterization of HIV-1 virus protein U cytoplasmic domain in the presence of dodecylphosphatidylcholine micelles doc

... binding and degradation [63]. In particular, an interaction between the cytoplasmic domains of CD4 and VpU is no longer detectable in a yeast two-hybrid assay if D77 of VpU is replaced by asparagine ... interaction. The distinguished protein confor- mation is then recognized by the binding partner. Directed withdrawal of a particular conformational subpopulation from...
Ngày tải lên : 18/02/2014, 06:20
  • 16
  • 632
  • 0
Báo cáo khoa học: Complementation of coenzyme Q-deficient yeast by coenzyme Q analogues requires the isoprenoid side chain ppt

Báo cáo khoa học: Complementation of coenzyme Q-deficient yeast by coenzyme Q analogues requires the isoprenoid side chain ppt

... h, at which point it had reached A 600  0.8 and already been sta- tionary for several hours and would remain that way for a number of days (squares). At the point indicated by the arrow, a mixture ... this was a valid assumption as loss of area from the CoQ 2 H 2 and decylQH 2 peaks was compara- ble with the gain in size of the CoQ 2 and decylQ peaks. Determination of...
Ngày tải lên : 06/03/2014, 11:20
  • 16
  • 499
  • 0
Báo cáo khoa học: Autocatalytic processing of procathepsin B is triggered by proenzyme activity doc

Báo cáo khoa học: Autocatalytic processing of procathepsin B is triggered by proenzyme activity doc

... 5¢-CCAG AACGTTATGTTTGCAGCTGCACTGAAGCTGCCTGC-3¢ (for the TED58AAA mutant: R54N, T5 8A, E5 9A, D6 0A) ; 5¢-CCCAGAACGTTATGGCTGCAGCTGCACTGAAGC TGCCTG-3¢ (for the FTED57AAAA mutant: R54N, F5 7A, T5 8A, E5 9A, D6 0A) ; 5¢-CCAGAACGTTATGGC TACCGAGGACCTGAAGC-3¢ ... [3–5], rheumatoid arthritis and osteoarthritis [3,6]. Cysteine cathepsins, including cathepsin B, are syn- thesized as inactive proenz...
Ngày tải lên : 07/03/2014, 03:20
  • 9
  • 425
  • 0
Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx

Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx

... generated from first-strand cDNA and the following primers (NKA48, accession number DQ017261): 5¢-GATGCATAATACGACTCACTATAGG GAAATGTCCGTCCAACAAGGAG-3¢ (forward) and 5¢- GCCTTCTAATACGACTCACTATAGGGACCACGATG ATGGATGAAATG-3¢ ... 5¢-GAT GCATAATACGACTCACTATAGGGAGTGCCTTGCAA GGAGTATTG-3¢ and the reverse primer was 5¢-GCCTTC TAATACGACTCACTATAGGGAGCTCGTAATAGCTT TTGGAC-3¢, the resulting DNA spanni...
Ngày tải lên : 07/03/2014, 12:20
  • 10
  • 639
  • 0
Báo cáo khoa học: Specific degradation of H. pylori urease by a catalytic antibody light chain pptx

Báo cáo khoa học: Specific degradation of H. pylori urease by a catalytic antibody light chain pptx

... natural catalytic antibodies have been discov- ered in the last decade. The first natural catalytic anti- body was isolated from the serum of an asthma patient [1], and this antibody enzymatically ... a Gram-negative spiral bacteria infecting about 50% of the world’s population, is an etiologic agent in a variety of gastroduodenal diseases and is the only microorganism...
Ngày tải lên : 07/03/2014, 21:20
  • 9
  • 388
  • 0
Báo cáo khoa học: Regulation of luteinizing hormone receptor mRNA expression by mevalonate kinase – role of the catalytic center in mRNA recognition potx

Báo cáo khoa học: Regulation of luteinizing hormone receptor mRNA expression by mevalonate kinase – role of the catalytic center in mRNA recognition potx

... produce any change in the RNA binding activity of MVK (Fig. 5). As a decrease in the RNA binding activity of MVK was observed when the amino acids at the active site were mutated, we examined the ... hypothesis. Two structural scenarios that explain the present muta- genesis data are as follows: (a) the RNA binding site overlaps with the site of ATP binding and may explo...
Ngày tải lên : 16/03/2014, 06:20
  • 11
  • 367
  • 0
Báo cáo khóa học: Endoplasmic reticulum-associated degradation of glycoproteins bearing Man5GlcNAc2 and Man9GlcNAc2 species in the MI8-5 CHO cell line docx

Báo cáo khóa học: Endoplasmic reticulum-associated degradation of glycoproteins bearing Man5GlcNAc2 and Man9GlcNAc2 species in the MI8-5 CHO cell line docx

... released from the glycoprotein fraction by the action of PNGase. They were then analyzed by HPLC after mild acid treatment and the sequential action of b-galactosidase and b-hexosaminidase as ... Glc1Man5Glc- NAc2/Glc1Man9GlcNAc2 obtained with the glycoprotein pattern. This indicates that, when glycoproteins bearing Man9 and Man5 are synthesized in the same cell line, those...
Ngày tải lên : 16/03/2014, 16:20
  • 7
  • 391
  • 0
Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot

Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot

... e.g., after viral infection. We show that human IFN-b mRNA follows an asynchronous deadenylation pathway typical of a mRNA containing a class II ARE. A deletion analysis of the IFN-b natural transcript ... c-fos, it was shown that ARE mediates mRNA deadenylation by a translation- independent mechanism, while the coding region instabi- lity determinant facilitates mRNA deadenylat...
Ngày tải lên : 17/03/2014, 10:20
  • 8
  • 361
  • 0
Báo cáo khoa học: Crystal structures of HIV protease V82A and L90M mutants reveal changes in the indinavir-binding site potx

Báo cáo khoa học: Crystal structures of HIV protease V82A and L90M mutants reveal changes in the indinavir-binding site potx

... indinavir, of 3.8 A ˚ .In PR V8 2A , the change in the position of the main chain atoms placed the Cb atom of Ala82 within reasonable van der Waals distance of indinavir (4.1 A ˚ ), resulting in a ... residue in the active site of the protease that is critical to inhibitor binding, L90M is distal to the inhibitor-binding site and is located near the dimeri...
Ngày tải lên : 23/03/2014, 12:20
  • 9
  • 355
  • 0

Xem thêm