Báo cáo khoa học: Mapping the binding domains of the aIIb subunit A study performed on the activated form of the platelet integrin aIIbb3 pot

... Mapping the binding domains of the a IIb subunit A study performed on the activated form of the platelet integrin a IIb b 3 Nikolaos Biris 1 , Morfis Abatzis 1 , John V. Mitsios 1 , Maria Sakarellos-Daitsiotis 1 , ... fibrinogen -binding domains on the a IIb subunit was accomplished and their potential role in platelet aggregation was determi...

Ngày tải lên: 31/03/2014, 07:20

... in Drosophila melanogaster and Caenorhabditis elegans as an activator of the Ras pathway as mutations in KSR resulted Fig. 1. MAPK modules and their associated functions in Saccharomyces cerevisiae. 3292 ... plays a major role in the inactivation of the first peak of ERK activation. The delayed phase of ERK inactivation is dependent on protein synthesis, indicating that neo...

Ngày tải lên: 31/03/2014, 07:20

... the maximal mAb ⁄ heparin effect on the functional activ- ity of TC. Arrows show the hypothetical movement of the domains after attachment of Cbl, see the main text. Mapping of transcobalamin ... were Table 3. Specificity of monoclonal anti-(human transcobalamin) sera and their effect on the functional properties of transcobalamin. nd, not done. mAb Epitope clus...

Ngày tải lên: 20/02/2014, 01:20

... ATT GTC ATT CGC CTG ACG C-3¢ T02 5¢-GCT TAA GAG GTT TCA TAT GGT TGC TGA ATT G-3¢ PDH96 5¢-GGA TTT AAA ACA CAT ATG CCG TCA CTG CGT CCG GTG-3¢ PDH93 5¢-CGA CAA AGG ACA TAT GCA ACT TTG TCC GTC ACT ... PDH, and induces aggregation of the T-protein [3]. An analogous bifunctional protein in E. coli, known as the P-protein, contains CM and prephenate dehydratase (PDT), and catalyzes the tran...

Ngày tải lên: 31/03/2014, 07:20

... concen- tration of heterologous drug or nucleotide was expressed as a fraction of that obtained with radiolabel alone. The fraction bound was plotted as a function of added drug concentration, and nonlinear ... Thus, ATP and vanadate generate an ADP-vanadate struc- ture mimicking the transition state for the hydrolysis of the c-phosphate of ATP [30]. Figure 5 demon- stra...

Ngày tải lên: 18/02/2014, 18:20

... obtain information about how the conform- ational change initiated by the binding of Mab-1 spreads through the molecule. Generally, observation of a substi- tution having a different effect on ... Data from all determinations are shown in Table 2. Table 2. Effect of Mab-1 on the rate of latency transition of PAI-1. PAI-1 alone, with Mab-1, or with VN, was incubated...

Ngày tải lên: 20/02/2014, 11:20

... GCCCCATGGCGGTGGATGGCATATGGGAGG GGGTACCC PrP105–231 GGAACAAGCCCAGCCATATGAAAACCAACC TCAAGC PrP113–231 CCAACCTCAAGCATATGGCAGGG PrPD35–45 GGGTGGAACACCGGTGGCAACCGTTACCC PrP112–119 CCTCAAGCATGTGGTAGTGGGGGGCC PrPD112–136 ... – 6H3 Conformational – 9H7 Conformational – 7A9 Conformational + 1C10 Conformational + 3370 T. Cui et al. (Eur. J. Biochem. 270) Ó FEBS 2003 added to the assay mixture at tim...

Ngày tải lên: 21/02/2014, 00:20

... into a pBluescript vector, was used as template for the amplifica- tion of the MUC5AC sequence. With use of the primer pair 5¢-TATTCTAGAG AAGAGGGCCT GGTGTGCCGG AACCAGGACC AGCAGGGACC CTTCAAG-3¢ ... of the mAb against myc. One reason for the requirement of the N-terminal 91 amino acids could be that these are necessary for the correct folding of the protein, and that...

Ngày tải lên: 07/03/2014, 05:20

... the acceleration of the ribose 2¢-hydroxyl group deprotonation, stabilization of a negative charge that may develop on the nonbridging oxygen in a transition state, and ⁄ or stabilization of the negative ... T, Orita M & Taira K (2002) A reappraisal, based on (31)P NMR, of the direct coordination of a metal ion with the phosphoryl oxygen at the cleavage...

Ngày tải lên: 07/03/2014, 10:20

... of these three azoles, the optical change observed upon azole addition occurred linearly with increasing azole concentrations, reaching a plat- eau at a concentration range similar to that of ... Green AJ, Munro AW, Cheesman MR, Reid GA, von Wachenfeldt C & Chapman SK (2003) Expression, purification and characterisation of a Bacillus subtilis ferredoxin: a potential electro...

Ngày tải lên: 07/03/2014, 16:20