Báo cáo khoa học: Mapping the binding domains of the aIIb subunit A study performed on the activated form of the platelet integrin aIIbb3 pot

... Mapping the binding domains of the a IIb subunit A study performed on the activated form of the platelet integrin a IIbb3Nikolaos Biris1, Morﬁs Abatzis1, John V. Mitsios1, Maria Sakarellos-Daitsiotis1, ... ﬁbrinogen -binding domains on the a IIb subunit was accomplished and their potentialrole in platelet aggregation was determined. More speci-ﬁcally, a detailed mapping of the a IIb subunit was performed using ... platelet activation. The rationale of this study was based on the assumptionthat peptide fragments derived from the a IIb subunit couldact as inhibitors of platelet aggregation through their directinteraction...

Báo cáo khoa học: Fidelity and spatio-temporal control in MAP kinase (ERKs) signalling Delivered on 24 October 2002 at the 28th FEBS Meeting in Istanbul potx

... inDrosophila melanogaster and Caenorhabditis elegans as anactivator of the Ras pathway as mutations in KSR resultedFig. 1. MAPK modules and their associated functions in Saccharomycescerevisiae.3292 ... plays a major role in the inactivation of the ﬁrst peak of ERK activation. The delayed phase of ERK inactivation is dependent on protein synthesis, indicating that neosynthesized phospha-tases ... [31].Moreover, the phosphorylation state of partners can alsomodulate the afﬁnity of the interaction. For example, the association of ERK with its substrate, Elk1, is enhancedupon ERK activation [32],...

Tài liệu Báo cáo khoa học: Mapping the functional domains of human transcobalamin using monoclonal antibodies pptx

... the maximalmAb ⁄ heparin effect on the functional activ-ity of TC. Arrows show the hypotheticalmovement of the domains after attachment of Cbl, see the main text. Mapping of transcobalamin ... wereTable 3. Speciﬁcity of monoclonal anti-(human transcobalamin) sera and their effect on the functional properties of transcobalamin. nd, notdone.mAbEpitopeclusterPrecipitation of Apo-TC ... Quadros EV,McLoughlin P & Morgan AC (1996) Synthesis of coba-lamin–biotin conjugates that vary in the position of cobalamin coupling. Evaluation of cobalamin derivative binding to transcobalamin...

Báo cáo khoa học: Mapping of chorismate mutase and prephenate dehydrogenase domains in the Escherichia coli T-protein doc

... ATT GTC ATT CGC CTG ACG C-3¢T02 5¢-GCT TAA GAG GTT TCA TAT GGT TGC TGA ATT G-3¢PDH96 5¢-GGA TTT AAA ACA CAT ATG CCG TCA CTG CGT CCG GTG-3¢PDH93 5¢-CGA CAA AGG ACA TAT GCA ACT TTG TCC GTC ACT ... PDH, and induces aggregation of the T-protein [3]. An analogous bifunctional protein in E. coli,known as the P-protein, contains CM and prephenatedehydratase (PDT), and catalyzes the transformation ... stored in the assay buffer. Because of the instability of the T-protein, all assays were performed on fresh enzyme. Controls indicated negligible loss of activity on the day that assays were conducted....

Tài liệu Báo cáo khoa học: Is ATP binding responsible for initiating drug translocation by the multidrug transporter ABCG2? docx

... concen-tration of heterologous drug or nucleotide was expressed as a fraction of that obtained with radiolabel alone. The fraction bound was plotted as a function of added drugconcentration, and nonlinear ... Thus,ATP and vanadate generate an ADP-vanadate struc-ture mimicking the transition state for the hydrolysis of the c-phosphate of ATP [30]. Figure 5 demon-strates the effect of pre-incubation of ... mediation of drug binding site reorientation, although the binding data cannotunequivocally inform on the orientation of the sites,only their afﬁnity for interaction with drugs. The data presented...

Tài liệu Báo cáo khoa học: Mapping of the epitope of a monoclonal antibody protecting plasminogen activator inhibitor-1 against inactivating agents pptx

... obtain information about how the conform-ational change initiated by the binding of Mab-1 spreadsthrough the molecule. Generally, observation of a substi-tution having a different effect on ... Data from alldeterminations are shown in Table 2.Table 2. Eﬀect of Mab-1 on the rate of latency transition of PAI-1.PAI-1 alone, with Mab-1, or with VN, was incubated at 37 °C ;the PAI-1 concentration ... K325/33 5A. Conclusively, on the basis of the reported observations,we propose that the binding of Mab-1 to PAI-1 results in a conformational change of hC and the hI-s 5A loop whichspreads to the ﬂexible joint region,...

Tài liệu Báo cáo khoa học: Mapping the functional domain of the prion protein docx

... GCCCCATGGCGGTGGATGGCATATGGGAGGGGGTACCCPrP105–231 GGAACAAGCCCAGCCATATGAAAACCAACCTCAAGCPrP113–231 CCAACCTCAAGCATATGGCAGGGPrPD35–45 GGGTGGAACACCGGTGGCAACCGTTACCCPrP112–119 CCTCAAGCATGTGGTAGTGGGGGGCCPrPD112–136 ... –6H3 Conformational –9H7 Conformational – 7A9 Conformational +1C10 Conformational +3370 T. Cui et al. (Eur. J. Biochem. 270) Ó FEBS 2003added to the assay mixture at time zero and the activitymeasured ... reacts with a conformationalepitope in the C terminus [52].Analysis of the evolutionary conservation of the prionprotein among mammals clearly shows that all three critical domains (residues...

Báo cáo khoa học: Mapping of the 45M1 epitope to the C-terminal cysteine-rich part of the human MUC5AC mucin potx

... into a pBluescript vector, was used as template for the ampliﬁca-tion of the MUC5AC sequence. With use of the primerpair 5¢-TATTCTAGAG AAGAGGGCCT GGTGTGCCGGAACCAGGACC AGCAGGGACC CTTCAAG-3¢ ... of the mAb against myc. One reason for the requirement of the N-terminal 91 amino acids couldbe that these are necessary for the correct folding of the protein, and that the lack of them leads ... N-terminally as the von WillebrandD4 domain, as the reactivity of the mAb towards thisprotein is as strong as that against M-MUC5AC-CH-long. To rule out the possibility that the lack of reac-tivity...

Báo cáo khoa học: Mapping of the functional phosphate groups in the catalytic core of deoxyribozyme 10–23 potx

... the acceleration of the ribose2¢-hydroxyl group deprotonation, stabilization of a negative charge that may develop on the nonbridgingoxygen in a transition state, and ⁄ or stabilization of the negative ... T, Orita M & Taira K(2002) A reappraisal, based on (31)P NMR, of the direct coordination of a metal ion with the phosphoryloxygen at the cleavage site of a hammerhead ribozyme.J Am Chem ... (1999) A re-investigation of the thio effect at the hammerhead cleavage site. NucleicAcids Res 27 , 479–484.19 Yoshinari K & Taira K (2000) A further investigationand reappraisal of the thio...

Báo cáo khoa học: Kinetic and binding studies with purified recombinant proteins ferredoxin reductase, ferredoxin and cytochrome P450 comprising the morpholine mono-oxygenase from Mycobacteriumsp. strain HE5 ppt

... of these three azoles, the opticalchange observed upon azole addition occurred linearlywith increasing azole concentrations, reaching a plat-eau at a concentration range similar to that of ... Green AJ, Munro AW, Cheesman MR, Reid GA, vonWachenfeldt C & Chapman SK (2003) Expression,puriﬁcation and characterisation of a Bacillus subtilisferredoxin: a potential electron transfer donor ... spectra as a result of the displacement of a water molecule by an azole nitrogen to the sixthcoordination position of the heme iron [28]. The type II binding spectrum is characterized by a peak at432...

Xem thêm