Báo cáo khoa học: Assembly of collagen types II, IX and XI into nascent hetero-fibrils by a rat chondrocyte cell line ppt

... Assembly of collagen types II, IX and XI into nascent hetero-fibrils by a rat chondrocyte cell line Russell J. Fernandes 1 , Thomas M. Schmid 2 and David R. Eyre 1,3 1 Department of Orthopedics ... to intact collagen chains or to chain fragments. The various chains and chain fragments of types II, IX and XI collagen were resolved by SDS...

Ngày tải lên: 31/03/2014, 07:20

... 5¢-TGGGCGAGCTCATGAGCGACATT AAGAAATCTG-3¢ and 5¢-CGCTCAGAACGACACCG TTTG-3¢, covering 11 bp upstream of the start codon and the first 957 bp of the carB coding sequence, and 5¢- CGTTGAGGCACTGGTTAACG-3¢ and ... the manufacturer’s instructions. Two microlitres of cDNA were used for the amplification of carB using the primers 5¢-ATGAGCGACATTAAGAA ATCTG-3¢ and 5¢-CTAATTCGCAGCAATGACA...

Ngày tải lên: 30/03/2014, 01:20

... liver catalase and bovine intestine alkaline phospha- tase), phenyl–agarose, lectin-free Sepharose 4B and agarose- bound concanavalin A, LCA, RCA, DNase I, ethidium bromide and DNA size markers ... profile. Amphiphilic acetylcholinesterase and hydrophilic butyr- ylcholinesterase in the S1 supernatant of kidney were separated by taking advantage of the capacity of phenyl– agaro...

Ngày tải lên: 06/03/2014, 22:21

... subunits assembled into subcomplexes that may represent rate-limiting intermediates. We also found that Cox 6a and Cox 7a are incorporated into a novel intermediate complex of approximately 250 kDa, and ... Cox 6a and Cox 7a, an additional faster-migrating species accumulated, representing the mature form of the protein (Fig. 1B, lanes 2 and 3). An additional band seen af...

Ngày tải lên: 07/03/2014, 00:20

... Inoue 1,2, *, Kazunori Tanaka 1 , Hiromitsu Tanaka 2 , Kohei Ohtomo 1 , Toshio Kanda 2 , Morikazu Imamura 2 , Guo-Xing Quan 2 , Katsura Kojima 2 , Tetsuro Yamashita 3 , Tasuku Nakajima 4 , Hideharu Taira 3 , ... structure of the elementary unit of fibroin. Acknowledgements We thank Kazuko Seo and Hiroko Yamazaki, National Institute of Agrobiological Sciences, for technical assistance,...

Ngày tải lên: 16/03/2014, 16:20

... replotted against the ligand concentrations. The association and dissociation constants were obtained by lin- ear regression of the apparent rate constants versus ligand concentration data. Quench-flow ... 2249 5¢-GGAATTCCATATGGATATTGTATTTATAGAGCA AC-3¢ (forward primer with a Nde I site) and 5¢-CGGGA TCCTTAATTATTTTCTTTCAGATTATTGCC-3¢ (reverse primer with a BamHI site). The expressi...

Ngày tải lên: 19/02/2014, 00:20

... spectrum of C-LytA at 20 °C and pH 7.0, showing two maxima at 265 nm and 290 nm. Upon addition of 20 mm choline (a saturating concentration of ligand), two minima at 284 nm and 294 nm appear, whereas ... all C-LytA binding sites present the same high-affinity behavior for choline analogs and become saturated at 2mm (Fig. 2A) , and agrees with the higher apparent affinity of...

Ngày tải lên: 19/02/2014, 05:20

... Sonoda E, Sasaki MS, Buerstedde JM, Bezzubova O, Shinohara A, Ogawa H, Takata M, Yamaguchi-Iwai Y & Takeda S (1998) Rad51-deficient vertebrate cells accu- mulate chromosomal breaks prior to cell ... dichroism analysis and ATPase activities of the Rad51 mutants. (A C) CD spectra of HsRad51 (6.7 lM) and the Rad51 mutant (6.7 l M) were recorded at 25 °C. HsRad51 (A) ; Y23 2A mutan...

Ngày tải lên: 19/02/2014, 06:20

... hybridization to cDNA arrays (Atlas TM Human Cancer Array 1.2K from Clontech Laboratories Inc., Palo Alto, CA, USA). Total RNA for cDNA arrays was prepared using the Atlas TM pure total RNA Labeling ... NY, USA) for 7 days and scanned with a Storm 840 phosphorimager (Molecular Dynamics, Sunnyvale, CA, USA). Array data analysis Image analysis and quantification were carried out with Atlas...

Ngày tải lên: 07/03/2014, 16:20

... under- lined) or 5¢- TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary amplification with primers 5¢- CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag ... underlined) or 5¢- TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined) and 5¢-GCGGCATGCTCATCCAAAGAAGC TTGGGTCG-3¢. The two amplified fragments were used as a combined tem...

Ngày tải lên: 07/03/2014, 21:20