Báo cáo khoa học: The influence of temperature and osmolyte on the catalytic cycle of cytochrome c oxidase ppt
Báo cáo khoa học: The influence of temperature and osmolyte on the catalytic cycle of cytochrome c oxidase ppt
... concentrations of cytochrome c plus TMPD and ascorbate. As the concen- tration of cytochrome c is increased, the fraction of cytochrome a that is reduced increases. The fraction of cytochrome a ... second catalytic cycle of reduction of CCO by cytochrome c. Mitchell and Rich [47] proposed that two protons were taken up on reduction of CCO and th...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo khoa học: Nerve influence on myosin light chain phosphorylation in slow and fast skeletal muscles pdf
... decrease of mass) when compared with the corresponding muscles of the control animals (CONT) or with the muscles of the controlateral unoperated limb (CODE). The distribution of MHC and MLC isoforms ... low-frequency stimulation; COCsA, controls for CsA receiving cremophor A solution only; CODE, controlateral unoperated limb; CONT, control; CsA, cyclosporin A; ECL, enhance...
Ngày tải lên: 23/03/2014, 11:20
Báo cáo khóa học: CD38 is expressed as noncovalently associated homodimers on the surface of murine B lymphocytes doc
... primer 1: 5¢-(GACATCTTC CTCGagCGCTGCCTCATC)-3¢; CD38-G68E, primer 2: 5¢-(CCC TCTAGACCAGATCCTTCACGTATTAAGTC TACACG)-3¢; CD38-G68E, primer 3: 5¢-(GATGAGGC AGCG CTCGagGAAGATGTC)-3¢; CD38-G68E, primer 4: ... are indicated in lower case italics: CD38-E150L, primer 1: 5¢-(TACTT GGATCCAGGGAAAGATGTTCACCCTG ctGGACACCCTG)-3¢; CD38-E150L, primer 2: 5¢-(CC C TCTAGACCAGATCCTTCACGTATTAAGTCT ACACG)-3¢; CD...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khoa học: Plasmodium falciparum hypoxanthine guanine phosphoribosyltransferase Stability studies on the product-activated enzyme potx
... exert their action, at high concentrations, as nonspeci c polyanions blocking merozite invasion of the erythrocyte [10–13]. HGPRT is also of importance to the host, with the absence and the deficiency ... activity of the fully activa- ted enzyme, and the value obtained for the enzyme immediately after purification as the speci c activity of the unactivated enzyme...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Multifunctional host defense peptides: functional and mechanistic insights from NMR structures of potent antimicrobial peptides docx
... orientation without the need for insertion into the hydrophobic region of the bilayer. On the other hand, the presence of cholesterol reduced the tilt of the MSI-594 helix to within 5° and that of the ... multilamellar vesicles was used to determine the backbone conforma- tion and the membrane orientation of MSI peptides. Solid-state NMR experiments on li...
Ngày tải lên: 29/03/2014, 22:21
Báo cáo khoa học: "A Mention-Synchronous Coreference Resolution Algorithm Based on the Bell Tree" potx
... check the gender consistency when considering the active mention “she”. 3.3 Discussion There is an in-focus entity in the condition of the link- ing model (1) while the starting model (2) conditions on ... 1995) and ECM-F. The MUC score counts the common links be- tween the reference and the system output. 5.2 Results on the ACE data The system is first develope...
Ngày tải lên: 31/03/2014, 03:20
Tài liệu Báo cáo khóa học: Mutations in the hydrophobic core and in the protein–RNA interface affect the packing and stability of icosahedral viruses doc
... could not be determined because of the lack of change induced by pressure. Changes in secondary structure upon dissociation and denaturation To further confirm the urea-induced changes in secondary structure, ... scattering and spectral center of mass measurements of WT MS2 as a function of urea concentration. To verify the dissociation and denaturation processes, we meas...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt
... AGTTCA – Acyl-CoA oxidase A AGGACA a AGGTCA [54] Acyl-CoA oxidase B AGGTAG a AGGTCA [54] Lipoprotein Lipase TGCCCT t TCCCCC [58] Apolipoprotein AII CAACCT t TACCCT [68] Enoyl-CoA hydratase GACCTA ... (5¢-dCAA CCTTCAATGCCCCAGCCTAAATATCCTCTCCGGT-3¢; antisense primer) to generate pGL3b:Prm3ab PPARc(a) *. Mutation of the consensus retinoic acid X responsive element (RXR) half site with t...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Mitochondrial transcription factor A overexpression and base excision repair deficiency in the inner ear of rats with D-galactose-induced aging pdf
... calculator (BioChrom, Cambridge, UK). Quantification of the mitochondrial common deletion The proportion of the mitochondrial common deletion was determined with a TaqMan real-time PCR assay. The Accumulation of ... forward and reverse primer, and 0.2 lLof10lm each probe. The ampli- fication conditions were as follows: one cycle of 30 s at 95 C, and 40 cycles of 95 C...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Proteoglycans in health and disease: the multiple roles of syndecan shedding ppt
... units. The repeating unit of HS and chondroitin sulfate back- bones are glucuronic acid (GlcA)–N-acetylglucosamine (GlcNAc) or GlcA–N-acetylgalactosamine (GalNAc), respectively. These chains ... inhibition of cell invasion [92]. How- ever, the mechanism remains unknown. Integrins and syndecans together may influence the outcome of cell adhesion and migration because their d...
Ngày tải lên: 15/03/2014, 23:20