Báo cáo khoa học: "Dynamically Generating a Protein Entity Dictionary Using Online Resources" pdf

... three databases in PIR: the Protein Sequence Database (PSD), iProClass, and PIR-NREF. PSD database includes functionally an-notated protein sequences. The iProClass database is a central point ... records with information extracted from literature and curator-evaluated computational analy-sis. TrEMBL consists of computationally analyzed records that await full manual annotation. The Uni-Prot ... the ACL Interactive Poster and Demonstration Sessions,pages 17–20, Ann Arbor, June 2005.c2005 Association for Computational LinguisticsDynamically Generating a Protein Entity Dictionary Using...

Báo cáo khoa học: "Expanding Indonesian-Japanese Small Translation Dictionary Using a Pivot Language" pot

... Technologytsuchiya@imc.tut.ac.jp, {wakita,ayu,nakagawa}@slp.ics.tut.ac.jpAbstractWe propose a novel method to expand a small existing translation dictionary to a large translation dictionary using a pivot ... theworld. Actually, while rich resources are availablefor several popular language pairs like the Englishlanguage and the Japanese language, poor resourcesare only available for rest unfamiliar language ... source languageto the pivot language, and a large transla-tion dictionary from the pivot language tothe destination language. Experiments thatexpands the Indonesian-Japanese dictionary using...

Báo cáo khoa học: "Dialect MT: A Case Study between Cantonese and Mandarin" pdf

... Mandarin. 1 Dialects and Chinese Dialects Dialects of a language are that language's systematic variations, developed when people of a common language are separated geographically and ... et. al. 1992). The task is so demanding that some researchers are looking more seriously at machine-aided human translation as an altemative way to achieve automatic machine translation (Martin, ... newspapers which are totally unintelligible to Mandarin speakers, while Mandarin articles are easily understood by Cantonese speakers. To translate a Cantonese article into Mandarin, the primary...

Báo cáo khoa học: "Designing spelling correctors for inflected languages using lexical transducers" pdf

... Proceedings of EACL '99 Designing spelling correctors for inflected languages using lexical transducers I. Aldezabal, I. Alegria, O. Ansa, J. M. Arriola and N. Ezeiza University of the Basque ... tool is based in lexical transducers and is built using the fst library of Inxight 1. A lexi- cal transducer (Karttunen, 94) is a finite-state au- tomaton that maps inflected surface forms ... lemmas corre- sponding to this word-form and the gram- matical category of each one. The resulting lexical transducer is very compact and fast. 2. a searcher of these hypothetical lemmas in...

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... sequencingand mutational analysis of a gene cluster involved innitrite reduction in Paracoccus denitriﬁcans. AntonieLeeuwenhoek 66, 111–127.13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997)Gene ... FEBS23 Chang CK (1994) Heme d1and other heme cofactorsfrom bacteria. Ciba Found Symp 180, 228–238.24 Van Spanning RJ, Wancell CW, De Boer T, HazelaarMJ, Anazawa H, Harms N, Oltmann LF & ... similarity. A crystalstructure of Met8P has shown that this protein hasan aspartate residue (Asp141), which is importantfor both chelatase and dehydrogenase function [17];interestingly, this aspartate,...

Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

... analysis was performed using the graphpadprism, version 5 (GraphPad Software, Inc., San Diego, CA,USA). Statistical signiﬁcance was calculated using Student’st-test. Statistical signiﬁcance was deﬁned ... zymog-raphy, as described previously [73]. Quantiﬁcation of MMP2was performed using imagequant tl software, version 7.0(GE Heathcare, Little Chalfont, UK).Statistical analysisStatistical analysis ... & Stack MS (1999) Membraneassociated matrix metalloproteinases in metastasis.Bioessays 21, 940–949.4 Sato H, Takino T & Miyamori H (2005) Roles ofmembrane-type matrix metalloproteinase-1...

Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

... ON357, 5¢-TGAAACATCACCAACTAAATCTCCAA-3¢; ON358, 5¢-GACGACTCCATTGTTATAGGAAAAGAGT-3¢; ON359, 5 ¢-GCCGCTGGAGAAACAGCAT-3¢; ON360, 5¢-GCCACCCATTCGTCACAATC-3¢;and ON361, 5¢-ATGCAGAAGGGGATCCGG-3¢.Direct ... MAP kinase activation.Nature 383, 547–550.6 Toki S, Kawasaki H, Tashiro N, Housman DE &Graybiel AM (2001) Guanine nucleotide exchange fac-tors CalDAG-GEFI and CalDAG-GEFII are coloca-lized ... the supernatants were quanti-ﬁed by the BC assay quantiﬁcation kit (Uptima) using BSAas the standard. Equal amounts of protein were preparedfor separation by SDS ⁄ PAGE.ImmunoprecipitationHEK293...

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... nativesignal peptide was ampliﬁed by PCR using the followingprimers: 5¢ primer, 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak ... is monomeric at neutral pH. Using ASA, a ﬂuorescent fatty acid anthroyloxy analogue as a probe, ASP3c was shown to bind speciﬁcally to large fattyacids and ester derivatives, which are brood pheromonecomponents, ... BrC15-Ac was shown to efﬁcientlyquench W81, as observed with M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated...

Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING ﬁnger protein Unkempt doc

... Y, Minoshima Y, Hatori T, Tsuchiya A, Kiyono M, Nosaka T et al. (2006) Rac1 and a GTPase-activating protein, MgcRacGAP, are required fornuclear translocation of STAT transcription factors.J ... assemblies containingeither Brm or Brg1 as the catalytic ATPase subunit and a variable subset ofapproximately 10 Brg⁄ Brm-associated factors (BAF). Among these factors,BAF60 proteins (BAF6 0a, BAF60b ... ReddyVA, Orth A, Chanda SK, Batalov S & Joazeiro CA(2008) Genome-wide and functional annotation ofhuman E3 ubiquitin ligases identiﬁes MULAN, a mitochondrial E3 that regulates the organelle’s...

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

... GGCTTCCATGGCATACTCCACARP Cardiac ankyrin repeat protein NM_013468 616mCARP.F: CTTGAATCCACAGCCATCCA641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC706mCARP.R: TGGCACTGATTTTGGCTCCTE2-14 kDa Ubiquitin-conjugating ... CGCTTTCGGAGGTGCTTTCGCAGM1941p65.R: TCAGAGTTCCCTACCGAAGCAGP0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGAM225PO.P: CCGTGGTGCTGATGGGCAAGAAM267PO.R: ACCATGATGCGCAAGGCCATp21WAF1/CIP1Cyclin-dependent ... CCAGCTCAAATGCTAGTACCATCAGTGGGAG1445mFoxO1.R: GTCCCCATCTCCCAGGTCATMAFbx F-box only protein 32 (Fbox32) NM_026346 1235mMafBx.F,CTGGAAGGGCACTGACCATC1265mMafBx.P, CAACAACCCAGAGAGCTGCTCCGTCTC1353mMafBx.R,...

Xem thêm