Báo cáo khoa học: "Dynamically Generating a Protein Entity Dictionary Using Online Resources" pdf
... three databases in PIR: the Protein Sequence Database (PSD), iProClass, and PIR-NREF. PSD database includes functionally an- notated protein sequences. The iProClass database is a central point ... records with information extracted from literature and curator-evaluated computational analy- sis. TrEMBL consists of computationally analyzed records that await full manual annotation. T...
Ngày tải lên: 31/03/2014, 03:20
... Technology tsuchiya@imc.tut.ac.jp, {wakita,ayu,nakagawa}@slp.ics.tut.ac.jp Abstract We propose a novel method to expand a small existing translation dictionary to a large translation dictionary using a pivot ... the world. Actually, while rich resources are available for several popular language pairs like the English language and the Japanese language, poor resources are only a...
Ngày tải lên: 23/03/2014, 18:20
... Mandarin. 1 Dialects and Chinese Dialects Dialects of a language are that language's systematic variations, developed when people of a common language are separated geographically and ... et. al. 1992). The task is so demanding that some researchers are looking more seriously at machine-aided human translation as an altemative way to achieve automatic machine translation (Mar...
Ngày tải lên: 23/03/2014, 19:20
Báo cáo khoa học: "Designing spelling correctors for inflected languages using lexical transducers" pdf
... Proceedings of EACL '99 Designing spelling correctors for inflected languages using lexical transducers I. Aldezabal, I. Alegria, O. Ansa, J. M. Arriola and N. Ezeiza University of the Basque ... tool is based in lexical transducers and is built using the fst library of Inxight 1. A lexi- cal transducer (Karttunen, 94) is a finite-state au- tomaton that maps inflected sur...
Ngày tải lên: 17/03/2014, 23:20
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans. Antonie Leeuwenhoek 66, 111–127. 13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997) Gene ... FEBS 23 Chang CK (1994) Heme d 1 and other heme cofactors from bacteria. Ciba Found Symp 180, 228–238. 24 Van Spanning RJ, Wancell CW, De Boer T, Hazelaar MJ, Anazawa H, Harms N, Oltma...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf
... analysis was performed using the graphpad prism, version 5 (GraphPad Software, Inc., San Diego, CA, USA). Statistical significance was calculated using Student’s t-test. Statistical significance was defined ... zymog- raphy, as described previously [73]. Quantification of MMP2 was performed using imagequant tl software, version 7.0 (GE Heathcare, Little Chalfont, UK). Statistical analysis S...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx
... ON357, 5¢-TGAAACATCACCAACTAAATC TCCAA-3¢; ON358, 5¢-GACGACTCCATTGTTATAGG AAAAGAGT-3¢; ON359, 5 ¢-GCCGCTGGAGAAACAG CAT-3¢; ON360, 5¢-GCCACCCATTCGTCACAATC-3¢; and ON361, 5¢-ATGCAGAAGGGGATCCGG-3¢. Direct ... MAP kinase activation. Nature 383, 547–550. 6 Toki S, Kawasaki H, Tashiro N, Housman DE & Graybiel AM (2001) Guanine nucleotide exchange fac- tors CalDAG-GEFI and CalDAG-GEFII are coloca...
Ngày tải lên: 19/02/2014, 18:20
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf
... native signal peptide was amplified by PCR using the following primers: 5¢ primer, 5¢-GAGCCCGGATCCACCATGAA GGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAAT TCTTAAACATTAATGCC 3¢. These primers encoded a Kozak ... is monomeric at neutral pH. Using ASA, a fluorescent fatty acid anthroyloxy analogue as a probe, ASP3c was shown to bind specifically to large fatty acids and ester derivatives, whic...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc
... Y, Minoshima Y, Hatori T, Tsuchiya A, Kiyono M, Nosaka T et al. (2006) Rac1 and a GTPase- activating protein, MgcRacGAP, are required for nuclear translocation of STAT transcription factors. J ... assemblies containing either Brm or Brg1 as the catalytic ATPase subunit and a variable subset of approximately 10 Brg⁄ Brm-associated factors (BAF). Among these factors, BAF60 proteins (BAF6...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
... GGCTTCCATGGCATACTCCA CARP Cardiac ankyrin repeat protein NM_013468 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: TGGCACTGATTTTGGCTCCT E2-14 kDa Ubiquitin-conjugating ... CGCTTTCGGAGGTGCTTTCGCAG M1941p65.R: TCAGAGTTCCCTACCGAAGCAG P0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATG...
Ngày tải lên: 07/03/2014, 03:20