Báo cáo khoa học: "You Can’t Beat Frequency (Unless You Use Linguistic Knowledge) – A Qualitative Evaluation of Association Measures for Collocation and Term Extraction" pot

... Linguistics You Can’t Beat Frequency (Unless You Use Linguistic Knowledge) – A Qualitative Evaluation of Association Measures for Collocation and Term Extraction Joachim Wermter Udo Hahn Jena University Language ... Chapter of the Association for Com- putational Linguistics, pages 18 8–1 95. Toulouse, France, July 9-11, 2001. San Francisco,...

Ngày tải lên: 31/03/2014, 01:20

... understanding of the role of KCNE4 as a potentially important regulator of KCNQ1 and other K V channels. Results Characterization of KCNE4 antibody A rabbit polyclonal antibody raised against a C-termi- nal ... inactivation behaviour of voltage-gated K-channels may be determined by association of alpha- and beta-subunits. J Physiol Paris 88, 17 3–1 80. Supplementary...

Ngày tải lên: 18/02/2014, 17:20

... assays would expand the current platform of tests for the determination of the biocompatibility of nanomaterials. Abbreviations DIV 8, day (in vitro) 8; FAS, fatty acid synthase; FFA, free fatty ... (Burlington, Canada); Oil Red O, Harris hematoxylin, polyornithine and laminine from Sigma (Oakville, Canada); formalin from Fisher Scientific (Nepean, Canada); Alamar blue reagent from B...

Ngày tải lên: 07/03/2014, 00:20

... existence of learnt and handwritten grammars of natural languages. A great many formalisms have been advanced that fall into either of the two variants, but even the best of them cannot be said to ... guide the parser when it has no other means of making an attachment decision. Finally, the parser and grammar are freely available for use and modi- fication (http://nats-ww...

Ngày tải lên: 17/03/2014, 04:20

... (and a morphological analyzer), and a fair amount of unlabeled training data, but hardly any annotated corpora. We actually report results on full morphological disambiguation for Hebrew, a task ... estimate the probability of a tag given a context as the average probability of a tag given any of the words appearing in that context, and similarly the probability of...

Ngày tải lên: 31/03/2014, 00:20

... mutants and GAL4-GRASP55 revealed that, apart from the VP16-MT1 FFR (Fig. 5A, lane 3) and VP16-MT1 DKV mutants (Fig. 5A, lane 9), all the other triple mutants (Fig. 5A, lanes 4–8 ) displayed a marked ... Beznoussenko G, Savarese M, Marra P, Di Tullio G, Martire G, De Matteis MA & Bonatti S (2009) GRASP65 and GRASP55 sequentially promote the transport of C-terminal valine-bear...

Ngày tải lên: 18/02/2014, 04:20

... N-terminal hexahistidine tag was obtained by PCR using the pET2 1a ⁄ PNT- H6 plasmid [30] as the template. The forward primer (5¢-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3¢) was designed to insert a ClaI ... N-terminus was obtained by PCR from the plasmid pET21 ⁄ SIC1 [32] with a forward primer (5¢-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3¢) designed to introduce a he...

Ngày tải lên: 18/02/2014, 04:20

... NirE_Compl _for (GA GAATTCGGA AATCGGCCTCG) and NirE_Compl_rev (CT AAGCTTT CAGGCGCATGCG) for the nirE gene and CobA_ Compl _for (GA GAATTCACTGCTGGCGGCC) and CobA_Compl_rev (CT AAGCTTTCAGGCGCTCAGGG) for ... recombinant NirE from Pseu- domonas aeruginosa and characterization of in vivo accumulated tetrapyrroles. (A) SDS ⁄ PAGE analysis of the production and purifi- cation of...

Ngày tải lên: 18/02/2014, 06:20

... tRNA Ser :SerRS complexes (lanes 1 and 5, respectively) have a pI value of approximately 5.2. Dimerization of archaeal tRNA transcript Unlike many other tRNAs, M. maripaludis and M. janna- schii tRNA Ser GCU transcripts ... m M MgCl 2 before placing on ice. The amount of active tRNA was determined by measuring aminoacylation plateau with homologous SerRSs (at 37 °CforM. maripaludi...

Ngày tải lên: 19/02/2014, 12:20

... extracts were analy zed by H PAEC-PAD. As a standard, a commercial maltodextrin sample (Dextrin 15, Fluka, Germany) was used. Data f rom a single e xperiment are shown. The maltod extrin patterns ... U25436) 5¢-ATGGCCAAGAAAGTTGCCATC TGT; 3¢-TCAGGTATCAGGCTTTGGGAATGC. RT- PCR was performed using SSII R NaseH – RT (Invitrogen, Karlsruhe, Germany) and High Fidelity Expand Poly- merase...

Ngày tải lên: 19/02/2014, 16:20