Báo cáo khoa học: The HS:1 serostrain of Campylobacter jejuni has a complex teichoic acid-like capsular polysaccharide with nonstoichiometric fructofuranose branches and O-methyl phosphoramidate groups pot

... revealed two separate reso- nances for Gal H-2, H-3 and H4 labeled A2 a ,A2 b, A3 a ,A3 b ,A4 a and A4 b, respectively. (Fig. 4A) . The 1D-NOESY of Gal H- 4a showed NOEs for Gal H- 2a, Gal H- 3a, Gal H-5 and ... J, Wang Y, Krueger WA, Madoff LC, Marti- rosian G, Boisot S, Goldmann DA, Kasper DL, Tziana- bos AO & Pier GB (1999) Isolation and chemical characterization of...

Ngày tải lên: 30/03/2014, 20:20

... (2005) The HS: 1 sero- strain of Campylobacter jejuni has a complex teichoic acid-like capsular polysaccharide with nonstoichiometric fructofuranose branches and O-methyl phosphoramidate groups. ... Sciences, National Research Council of Canada, Ottawa Ontario, Canada Campylobacter jejuni is one of the leading causes of human gastroenteritis a...

Ngày tải lên: 16/03/2014, 13:20

... were CP172 5¢-ATATTCCCCAAACAATACCC-3¢ and the anti- sense primer CP133 5¢-TTAAAACTGTGACGATGGT GGA-3¢ with the TAA termination anticodon shown in bold. Amplification reactions were performed in a final vol- ume ... Depurination in each lane was calculated by relating the amount of any rRNA frag- ment released upon aniline treatment with the amount of 5.8S rRNA (directly propo...

Ngày tải lên: 23/03/2014, 07:20

... between a- actinin and calpain 1 and locates binding motifs within regions where the EF-hand domains of the protease and the cytoskeletal protein are concentrated. The behaviour of calpain 1 toward ... of the binding calpain. The topology of the interface with respect to the catalytic domain II [1] and the cleavage site in target are also underlying. Two m...

Ngày tải lên: 07/03/2014, 21:20

... the recombinant mPC1 ⁄ 3, the presence of the 87 kDa form in excess of the 66 ⁄ 71 kDa facilitates isolation of the enzyme and helps in maintaining the enzymatic activity at a proper level. The ... acti- vation may thus be the consequence of an enhanced stability of the 66 kDa form. The CT-peptide is not cleaved by enzymatically active PC1 ⁄ 3 Another importa...

Ngày tải lên: 30/03/2014, 08:20

... GATCGGATCCACTCCGCCACTCAGAAACTTAG ERM N-terminal deletions 140S: GATCGAATTCTCACCCACCCATCAGAATC 200S: GATCGAATTCCCCCTGCAGATGCCAAAGATG 304S: GATCGAATTCGAAGTGCCTAACTGC 343S: GATCGAATTCGAGAGACTGGAAGGCAAAG 349Rb: ... GATCCGGCCGTCATGTGAAGCCACCAT 37-9S: GATCGCTAGCGTGTGATGAAGGCGGAGGCCTTGAATTCACG 37- 9A GATCCGGCCGATCCAGTCAGTCGTCTATAC 37-8S: GATCGCTAGCGTGTGATGAAGGCGGAGCAACAGCAGGAAGAC 1676S: GATCGCTAGCG...

Ngày tải lên: 30/03/2014, 09:20

... domain and the functional relationship of tandemly repeated domains in BPPs. We conjecture that dual-domain BPPs have succeeded evolutionarily because they can increase the amount of available ... was determined using the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released from I...

Ngày tải lên: 14/02/2014, 15:20

... damage of chloroplastic A 4 -GAPDH. Results Inactivation of A 4 -GAPDH by GSSG and other oxidants, and protection by substrate and cofactors Incubation of recombinant Arabidopsis A 4 -GAPDH with ... Arabidopsis A 4 -GAPDH The sequence encoding the putative mature form of the A. thaliana plastidial A 4 -GAPDH isoform (GapA-1 cDNA At3g26650 provided by TAIR, Sta...

Ngày tải lên: 19/02/2014, 05:20

... hexameric state (U 6 ) and monomeric state (6 U). Figure 4A shows that the native form of Hfq has an apparent molecular mass of 50 ± 10 kDa, while the unfolded state of Hfq has an average apparent ... between Proteobacteria, Firmicutes, Thermotogales and Aquificales. On the contrary, the C-terminal fragments are variable in length and amino acid composition. The posi...

Ngày tải lên: 19/02/2014, 12:20

... grapheme-phoneme mappings and hence, that they are more consistent with a parallel distributed approach than with the abstract rules hypothesis. . Statistical analysis of grapho- phonological correspondences ... both the immediate naming and the delayed naming task. By-subjects and by-items (Ft and F2, respectively) analyses of variance were performed with g...

Ngày tải lên: 20/02/2014, 19:20