Báo cáo khoa học: In vitro selection and characterization of a stable subdomain of phosphoribosylanthranilate isomerase potx

Báo cáo khoa học: In vitro selection and characterization of a stable subdomain of phosphoribosylanthranilate isomerase potx

Báo cáo khoa học: In vitro selection and characterization of a stable subdomain of phosphoribosylanthranilate isomerase potx

... selection and characterization of a stable subdomain of phosphoribosylanthranilate isomerase Wayne M. Patrick 1,2 and Jonathan M. Blackburn 1,3,4 1 Department of Biochemistry, University of Cambridge, ... of trPRAI-His The far-UV and near-UV CD spectra of trPRAI-His were recorded and analyzed in a manner identical with those for PRAI and FLAG-PRAI (vide...

Ngày tải lên: 30/03/2014, 20:20

14 382 0
Báo cáo khoa học: In vitro expansion of DNA triplet repeats with bulge binders and different DNA polymerases pdf

Báo cáo khoa học: In vitro expansion of DNA triplet repeats with bulge binders and different DNA polymerases pdf

... stimulation effect of DDI- 1A containing a right-handed aglycon helix was greater than that of DDI-1B; (e) the enhancement effects of DDI- 1A and DDI-1B on AAT, CAG and CA repeats are stronger than ... polynucleotide kinase. DNA polymerase assays A standard reaction (15 lL) contained 4 lm each of the primer and template and 1 mm each of deoxynucleoside tri- phosphate,...

Ngày tải lên: 07/03/2014, 06:20

12 473 0
Báo cáo khoa học: In vitro embryonic developmental phosphorylation of the cellular nucleic acid binding protein by cAMP-dependent protein kinase, and its relevance for biochemical activities pdf

Báo cáo khoa học: In vitro embryonic developmental phosphorylation of the cellular nucleic acid binding protein by cAMP-dependent protein kinase, and its relevance for biochemical activities pdf

... Calcaterra NB, Palatnik JF, Bustos DM, Arranz SE & Cabada MO (1999) Identification of mRNA-binding proteins during development: characterization of Bufo arenarum cellular nucleic acid binding ... were added to a final concentration of  2nm, and accurate molar amounts of fusion proteins were added as indicated. Final reaction volume was 20 lL. Binding reactions were incubated...

Ngày tải lên: 16/03/2014, 12:20

13 501 0
Báo cáo khoa học: In vitro gamma-secretase cleavage of the Alzheimer’s amyloid precursor protein correlates to a subset of presenilin complexes and is inhibited by zinc potx

Báo cáo khoa học: In vitro gamma-secretase cleavage of the Alzheimer’s amyloid precursor protein correlates to a subset of presenilin complexes and is inhibited by zinc potx

... cleavages by beta-site APP cleaving enzyme and c-secretase to form amyloid-b (Ab). The beta-site APP cleaving enzyme cleavage releases an APP ecto- domain leaving a 99-amino acid membrane spanning C-terminal ... 5¢-GGGGGGCCAT GGCGACAGTGATCGTC-3¢; reverse, 3FLAG HindIII creating the plasmid c-3FLAG standard. Finally, the pri- mer pairs forward, 5¢-GGGGGGCCATGGTGATGCTGA AGAAGAACAG-3¢ and...

Ngày tải lên: 16/03/2014, 23:20

14 421 0
Báo cáo khoa học: In vitro analysis of the relationship between endonuclease and maturase activities in the bi-functional doc

Báo cáo khoa học: In vitro analysis of the relationship between endonuclease and maturase activities in the bi-functional doc

... AnI19R 5¢-AATTCATGAGGAGGTTTCTCTGTAACA-3¢;AnI19H 5¢-AGCTTGTTACAG-AGAAACCTCCTCATG-3¢; AnI17R 5¢-AATTCACGAGGAGGTTTCTCTGTACTA-3¢; AnI17H 5¢-AGCTTAGTACAGAGAAACCTCCTCG TG-3¢;AnI15R5¢-AATTCACAGGAGGTTTCTCT-GTC TA-3¢;AnI15H5¢-AGCTTAGACAGAGAAACCTCC TGTG-3¢. Each annealed ... Coralville, IA, USA) were annealed together to make recognition site variants containing 5¢-EcoRI and 3¢-HindIII sticky ends: A...

Ngày tải lên: 17/03/2014, 10:20

12 483 0
Báo cáo khoa học: In vitro and in vivo self-cleavage of Streptococcus pneumoniae signal peptidase I pot

Báo cáo khoa học: In vitro and in vivo self-cleavage of Streptococcus pneumoniae signal peptidase I pot

... maintain the active SPase I at the highest level in the exponential growth phase. MATERIALS AND METHODS Materials and bacterial strains Restriction enzymes, T4 DNA ligase and Taq DNA polymerase ... template and two oligonucleo- tides as primers (5¢-GCAATGTTCGCGTACATATGCA TTCCATGGATCCGACC-3¢ and 5¢-TGGTGGTGCTC GAGAAATGTTCCGATACGGGTGATTGGCCAGA AGCG-3¢), which were designed to contai...

Ngày tải lên: 23/03/2014, 21:21

9 351 0
Báo cáo khoa học: "Investigating Cue Selection and Placement in Tutorial Discourse" ppt

Báo cáo khoa học: "Investigating Cue Selection and Placement in Tutorial Discourse" ppt

... this analysis into a database. The technique of representing an analysis in a database and then using database queries to test hypotheses is similar to work using RST analyses to investigate ... have applied RDA to our corpus of tutorial explanations, producing an exhaustive analysis of each explanation. By doing such an extensive analysis and representing the re- sults...

Ngày tải lên: 31/03/2014, 06:20

6 345 0
Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf

Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf

... (5¢-GCAAATGCAACTGGA AGCGG-3¢)andA1(5¢-ACAGCCTGCTAGCAAAGA GG-3¢) for amplification of HRT1, and primers S2 (5¢-GAAGAATCCTCTAAGGATAA-3¢)andA2(5¢-TA CAAGGATTAATCCCTTGC-3¢) for amplification of HRT2. ... Wititsuwannakul 4 , Seiji Takahashi 1 , Atiya Rattanapittayaporn 4 and Tanetoshi Koyama 1 1 Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai, Japa...

Ngày tải lên: 07/03/2014, 21:20

10 517 0
Báo cáo khoa học: "Test Collection Selection and Gold Standard Generation for a Multiply-Annotated Opinion Corpus" potx

Báo cáo khoa học: "Test Collection Selection and Gold Standard Generation for a Multiply-Annotated Opinion Corpus" potx

... High agreement To see how the generated gold standards agree with the annotations of all annotators, we analyze the kappa value from the agreements of each anno- tator and the gold standard ... N 3.3 Kappa value for agreement We further assess the usability of the annotated corpus by Kappa values. Kappa value gives a quantitative measure of the magnitude of inter- annotato...

Ngày tải lên: 08/03/2014, 02:21

4 418 0
Báo cáo khoa học: "SVM Model Tampering and Anchored Learning: A Case Study in Hebrew NP Chunking" pdf

Báo cáo khoa học: "SVM Model Tampering and Anchored Learning: A Case Study in Hebrew NP Chunking" pdf

... Anchored Learning is to add a unique feature a i (an anchor) to each training sample (we add as many new features to the model as there are training samples). These new features make our data ... SVM chunker on anchored data (as the anchored data is guaranteed to be linearly separable, we can set avery high value to the C parameter, preventing any mis- classification), and then investiga...

Ngày tải lên: 23/03/2014, 18:20

8 507 0
w