Báo cáo khoa học: Probing the access of protons to the K pathway in the Paracoccus denitrificans cytochrome c oxidase pdf
... Probing the access of protons to the K pathway in the Paracoccus denitrificans cytochrome c oxidase Oliver-M. H. Richter 1 , Katharina L. Du ¨ rr 1 , Aimo Kannt 2 , Bernd Ludwig 1 , Francesca ... employing this tech- nique in combination with site-directed mutants and isotopic labeling. Here mutants of E78 II in the Paracoccus cyto- chrome c oxidase...
Ngày tải lên: 30/03/2014, 15:20
... seen here indicating that occur- rence of an A24 C7 mismatch brings about signifi- cant reduction in adjacent base stacking in PD wt compared to PD mut . On the other hand, stacking at the AC(6–7) ... a (C6 ¢-N1¢ -C2 ¢ -C3 ¢), b(N1¢ -C2 ¢ -C3 ¢-N4¢), c( C2¢ -C3 ¢- N4¢ -C5 ¢), d (C3 ¢-N4¢ -C5 ¢ -C6 ¢), e(N4¢ -C5 ¢ -C6 ¢-N1¢), n (C5 ¢ -C6 ¢-N1¢ -C2 ¢), v1 (C8 ¢ -C7 ¢-N4¢ -C3 ¢), v2...
Ngày tải lên: 07/03/2014, 21:20
... that of the corresponding free inhibitor [47]. In the case of T–AT, the t ½ for the elimination of the complex from the circulation is in the order of several minutes [45,47]. The first receptor ... change in the serpin is exposure of structure(s) that are recognized by serpin–enzyme complex (SEC) receptors on the surface of hepatocytes. Receptor binding f...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt
... mm Ca 2+ . According to calculations using the spherical shape of macromolecules, the hydrodynamic radius of the protein will increase by 27% on formation of the dimer [22]. The increase in size ... oligomerizing to inter- act with the CRAC channel pore-forming subunit Orai1. In this work, we applied a grafting approach to obtain the intrinsic metal-binding affini...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Secondary structure assignment of mouse SOCS3 by NMR defines the domain boundaries and identifies an unstructured insertion in the SH2 domain pdf
... explain the KIR action is that it can mimic the activation loop found in kinases such as JAK2 and FGF receptor kinase [5] and prevent sub- strate access to the catalytic groove of the kinase ... domains are responsible for binding to phosphorylated tyrosine residues on intracellular domains of the cytokine receptors and ⁄ or the JAKs Keywords cytokine signalling; NMR;...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx
... bp) was PCR amplified from chromosomal DNA of P. furiosus using the primers BG1279 (5¢-GCGCG CCATGGCATCCGAGAAGATGGTTGCTATCA, sense) and BG1297 (5¢-GCGCG GGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense), ... the amino-acid sequence. The molecular mass of the native Pf-TDH was estimated to be 156 kDa by size-exclusion chromatography, which indicated a homotetrameric structure. Substr...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf
... argument favouring the importance of ArgB263 in substrate binding to PA. The pronounced difference in interaction energies of the two arginine residues shows certain capability of the pair of polar guanidinium ... residues in penicillin acylase [19] and AM1 docking calculations. The three N atoms of the side chain d-guanidino group of this residue are involved...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Expression and characterization of recombinant 2¢,5¢-oligoadenylate synthetase from the marine sponge Geodia cydonium ppt
... rate of 0.75 mLÆ min )1 for 40 min. The column was calibrated with 100 lg of each of the following substances: bovine serum albumin, chicken egg albumin, cytochrome c and tryptophan. After washing ... demonstrates the results of the purification of the recombinant proteins. The occurrence of dominant bands of the recombinant proteins provides evidence of a hig...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo khoa học: Irreversible cross-linking of heme to the distal tryptophan of stromal ascorbate peroxidase in response to rapid inactivation by H2O2 ppt
... H 2 O 2 . Keywords ascorbate peroxidase; chloroplast; cross-link; hydrogen peroxide; inactivation Correspondence S. Kitajima, Graduate School of Science and Technology, Kyoto Institute of Technology, Sakyo-ku, Kyoto ... isoform is irreversibly cross-linked to a tryptophan residue facing the distal cavity. Mutation of this tryptophan to phenylalanine abolished the cross-linking a...
Ngày tải lên: 30/03/2014, 08:20
Tài liệu Báo cáo khoa học: "Arabic Tokenization, Part-of-Speech Tagging and Morphological Disambiguation in One Fell Swoop" pdf
... which can be either filled or empty (in the case of the three clitic token fields) or correct or incorrect (in the case of the stem token field). We report in Figure 5 accuracy over all token fields ... whether it gets tokenized correctly, independently of the number of resulting tokens; the token-based measures refer to the four token fields into which the ATB splits...
Ngày tải lên: 20/02/2014, 15:20