Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot
... ARTICLE Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance Carla Esposito and Ivana Caputo Department of Chemistry, University of Salerno, ... human dis- eases. In this paper we review data on the properties of mammalian trans- glutaminases, particularly as regards their protein sub...
Ngày tải lên: 30/03/2014, 15:20
... number of tran- scriptional factors that are key regulators of HSC development. For instance, the stem cell leukemia factor Scl, has been shown to play a pivotal role in endothelial and hematopoietic ... hematopoietic com- partment using a CD34 + hESC-derived starting popu- lation has been considered as a potential AIDS therapy, and as a way to alleviate secondary ef...
Ngày tải lên: 22/03/2014, 17:20
... from sulfonoquinovosyl diacylglycerols of sea urchin. Trans- plantation 74, 261–267. 3 Mizushina Y, Watanabe I, Ohta K, Takemura M, Sahara H, Takahashi N, Gasa S, Sugawara F, Matsuk- age A, Yoshida S & Sakaguchi ... alga, Gigartina tenella. Chem Pharm Bull (Tokyo) 46, 684– 686. 5 Ohta K, Mizushina Y, Hirata N, Takemura M, Sugaw- ara F, Matsukage A, Yoshida S & Sakaguchi K (1999) A...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: "Time Period Identification of Events in Text" pptx
... large amount of unlabeled data, because to prepare a large quantity of labeled data is costly, while unlabeled data is easy to ob- tain. Specifically, we adopt the Naïve Bayes classifier backed ... periods of events. In contrast, we do not resort to such a hand-crafted material, which requires much labor and cost. Our method automatically acquires temporal information...
Ngày tải lên: 31/03/2014, 01:20
Báo cáo khoa học: "Corpus-Based Identification of Non-Anaphoric N o u n Phrases" potx
... is a daunt- ing and intractable task. We propose a corpus- based mechanism to identify non-anaphoric NPs automatically. We will refer to non-anaphoric definite noun phrases as existential ... inferable class, and our referentials to her evoked class. 374 not have direct antecedents in the text, we understand what they mean because they are all associated with bask...
Ngày tải lên: 31/03/2014, 04:20
Tài liệu Báo cáo khoa học: Oocyte membrane localization of vitellogenin receptor coincides with queen flying age, and receptor silencing by RNAi disrupts egg formation in fire ant virgin queens ppt
... of the SiVgR gene (amino acid 648–878) using primer set VgRi-f1 (5¢- TAATACGACTCACTATA GGGGCCATCTGCAATTATCAACGCCTTTCTTAACG TC-3¢) and VgRi-r1 (5¢- TAATACGACTCACTATAGGG ACCACATACTGTGCATCGCGTGAATAAGGTGTC-3¢), which ... (5¢- TAATACGACT CACTATAGGGCGTGATCAGGTCAAAACGTATTTTC TTCATTT-3¢) and VgRi-r3 (5¢- TAATACGACTCACTATA GGGGCCACAGTCAT CCTTTT TATCG CAT ACTAC -3¢) for dsRNA synthesis. This dsRN...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Photochemical cross-linking of Escherichia coli Fpg protein to DNA duplexes containing pdf
... Equal mobilities of the radioactive and the protein-containing bands indicated covalent attachment of DNA to the enzyme. The yield of the photochemical cross-linking reaction was calculated as ... is a DNA repair enzyme that catalyzes the removal of oxidized purine bases from damaged DNA and cleaves the DNA strand [6]. 7-Hydro-8- oxoguanine is the major mutagenic base produc...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo khoa học: "Lexicalized Stochastic Modeling of Constraint-Based Grammars using Log-Linear Measures and EM Training" ppt
...
Ngày tải lên: 20/02/2014, 18:20
Báo cáo khoa học: Ion-binding properties of Calnuc, Ca2+ versus Mg2+ – Calnuc adopts additional and unusual Ca2+-binding sites upon interaction with G-protein pdf
... N-terminal to the first EF-hand domain. In this regard, it is notable that D. melanogaster Calnuc has been predicted to have an additional EF-hand domain at a similar position [59]. Association of ... neurocalcin, phospholipase C, phospholi- pase A2 , GTPase KRas and Ras guanine nucleotide exchange factor, and RasGRP1 [31–35]. The Golgi apparatus has three Ca 2+ -binding pro- tein...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Phosphorylation-dependent binding of human transcription factor MOK2 to lamin A⁄C pot
... regula- tion may take place following activation of kinases such as PKA in response to various signaling pathways. In addition, Aurora A kinase is specifically activated before mitosis [25,26]. Mitotic ... phosphorylation status of hsMOK2. We identified Ser38 and Ser129 of hsMOK2 as phosphorylation sites of JNK3 kinase, and Ser46 as a phos- phorylation site of Aurora...
Ngày tải lên: 07/03/2014, 01:20