Báo cáo khoa học: Investigations of the supercoil-selective DNA binding of wild type p53 suggest a novel mechanism for controlling p53 function doc
Báo cáo khoa học: Investigations of the supercoil-selective DNA binding of wild type p53 suggest a novel mechanism for controlling p53 function doc
... its preference for scDNA (in the absence of m Abs, at p53/ scDNA ratios of 3 and 6, Fig. 5). Oxidized p53 exhibited similar binding to scDNA and linDNA in the absence of the other DNA form (Fig. 5, lanes ... of the intensity of the scDNA band in the absence of p53 (lane 1). On the contrary, ICA-9 did not inhibit binding of the p53 ox to scDNA in...
Ngày tải lên: 30/03/2014, 15:20
Báo cáo khoa học: Investigations into the ability of an oblique a-helical template to provide the basis for design of an antimicrobial anionic amphiphilic peptide pot
... membrane-interactive a- AMP. These data also suggest that the antimicrobial activity of AP1 depends on both the structural characteristics of its tilted peptide architecture and the lipid packing of ... use of an oblique-orientated a- helical template. It appears from the biophysical data that the peptide uses this structure for the destabilization of membranes of...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Investigations on the evolutionary conservation of PCSK9 reveal a functionally important protrusion pot
... homologs of the CRD appear to be present in proteins in the marine Califor- nia sea slug (Aplysia californica) and in the freshwater snail Biomphalaria glabrata. These CRD homologs were extracted ... 3) and the furin-cleaved PCSK9 (Fig. 5) appeared to migrate normally. To study whether the abnormal migration of the mature forms of R19 4A- PCSK9 and D20 4A- PCSK9 was due to...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc
... p Bottom O1 O2 O2 cl O3 O2 cro O1 O1 +–– –140 5'CATTTTCTTACCTCCTTAAATTTACCTATAGTATAACCCAATTATTTTTGGTATTCA GTAAAAGAATGGAGGAATTTAAATGGATATCATATTGGGTTAATAAAAACCATAAGT ACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTACACGTATCGTGTAT TGTTTTTTTATGTGCTTTTCGTTTGAAAATACAACTGAGTTCATGTGCATAGCACATA AGTAGGTTTTGTAAGCGGGAGGTGACAACATG TCATCCAAAACATTCGCCCTCCACTGTTGTAC ... in the major groove of the DNA...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc
... lower than that of isomaltase, respectively. The K m for a- pNPG of Mun/Bpu was the same a s that of isomaltase, whereas the K m for a- pNPG of M un/Bst was about 50 times l ower than that of isomaltase. ... GR287c. The sequence data for isomaltase is availab le from the DNA Data Bank of Japan with accession number AB109221. The entire coding region of t...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: "Completing on the partial basis parses of ill-formed sentences of discourse information" docx
... PP AJ N PP V PP what information is available about the AS/400 system. Candidates AJ N V AJ AJ DET N N for the POS AV AV of each word PN PP Phrases what information is available about the ... to as a discourse, the results indicate the averages obtained by referring to each of several sample areas as a dis- course. For example, to obtain data for the case in w...
Ngày tải lên: 08/03/2014, 07:20
Báo cáo khoa học: Mutations in the C-terminal domain of ALSV (Avian Leukemia and Sarcoma Viruses) integrase alter the concerted DNA integration process in vitro pot
... (5¢-CCGATATCATACTCTTCC-3¢)andBL(5¢-CC GATATCAGACCAAGTTTAC-3¢).Inthesameway ,the zeo gene was amplified from plasmid pHook (Invitrogen) using primers Z1 (5-CCGATATCGTGTTGACAATT AATC-3¢)andZ2(5¢-CCGATATCCAGACATGATAA GATAC-3¢). ... between target and viral DNAs, generating a duplication of target DNA. (B) In vitro assay. Representation of the donor DNA with 15 bp of the U3 viral e...
Ngày tải lên: 23/03/2014, 15:21
Báo cáo khoa học: Helicobacter pylori single-stranded DNA binding protein – functional characterization and modulation of H. pylori DnaB helicase activity pptx
... phos- phorimager (FujiÒlm-BAS-1800; Fuji, Tokyo, Japan) for quantitation. Helicase assay The substrate for helicase assay was prepared by annealing a 29 mer oligo (5¢-CCAAAACCCAGTCACGACGTTGT AAAACG-3¢) to M13mp18 ... pylori DnaB helicase activity Atul Sharma 1, *, Ram G. Nitharwal 1, *, Bhupender Singh 2 , Ashraf Dar 1 , Santanu Dasgupta 2 and Suman K. Dhar 1 1 Special Centre for Mo...
Ngày tải lên: 30/03/2014, 02:20
Tài liệu Báo cáo khoa học: X-ray crystallographic and NMR studies of pantothenate synthetase provide insights into the mechanism of homotropic inhibition by pantoate docx
... condensation of a molecule of b-alanine with a molecule of pantoate in an ATP-dependent manner to form pantothenate [1,2]. Pantothenate itself is an important cofactor that is essential for CoA biosynthe- sis, ... In an effort to unambiguously identify and understand the nature of binding of pantoate at the ATP -binding site, we also structurally characterized the pan...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf
... MT1-MMP GRASP55 complex can lead to a reduction of the MT1-MMP, and a consequent decrease of protease activity at the cell surface. Our data also revealed that intracellular furin levels are critical for ... [73]. Quantification of MMP2 was performed using imagequant tl software, version 7.0 (GE Heathcare, Little Chalfont, UK). Statistical analysis Statistical analysis was perf...
Ngày tải lên: 18/02/2014, 04:20