Báo cáo khoa học: A Kazal prolyl endopeptidase inhibitor isolated from the skin of Phyllomedusa sauvagii pdf

... identical to the inhibitor of acrosin – the major protease of mammalian spermatozoa – from the crab-eating monkey, Macaca fascicularis (Table 1). Whereas many Kazal inhibitors have proline at P 2 , ... PSKP-1 and PSKP-2, two variants of a new protein isolated from the skin of the anuran, P. sauvagii, whose sequence indicates membership of the Kazal famil...

Ngày tải lên: 30/03/2014, 13:20

... was suggested that amine oxidases are enzymes of cellular amino acid catabo- lism, comprising potential candidates for a mechanism that catalyses nitrogen mineralization from amino acids at the ... T.S. was also partially supported by a grant from the West- Ukrainian BioMedical Research Center. The technical assistance of Mrs Galina Shafranska during the cell culturing is...

Ngày tải lên: 29/03/2014, 08:20

... in Table 2. The symbol '+' is + in the unmarked case and - in the marked case, and 'x' stands for scalar multiplication. 4 In the case of the positive and the ordinary ... compositional approach may be manageable if certain assumptions about the application domain can be made. TOPIC AREAS: semantics, AI-methods in com- putational linguistics 1 Introdu...

Ngày tải lên: 01/04/2014, 00:20

... of a vitamin K-dependent carboxylase and of Gla in phyla as disparate as Chordata and Mol- lusca suggests the existence of an ancestral carboxyla- tion system with a purpose predating blood coagulation and ... for the cone snail carboxylase [8]. It is anticipated that addi- tional structural parameters such as the a- helicity of the propeptide and the position of cert...

Ngày tải lên: 23/03/2014, 11:20

... might ‘Susi heard that Hans had an accident and might die’ • Categorial (phrasal and lexical) nodes — bolded in Fig. 1 — carry reference tags (pre- sumably propagated from the generator’s strate- gic ... E.g., the tag “7” is attached to the root and head nodes of both exemplars of NP Hans in Fig. 1, indicating their coreferentiality. For the sake of computational uniformity, w...

Ngày tải lên: 22/02/2014, 02:20

... CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAG GGAT 1r TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC 2r CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG 3r GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA Reverse GCTA GGATCCCTAGCAACCACGGCAC Table 2. Antifungal activity ... Odintsova 1 , Alexander A. Vassilevski 2 , Anna A. Slavokhotova 1 , Alexander K. Musolyamov 2 , Ekaterina I. Finkina 2 , Natalia V. Khadeeva 1 , Eugene A. Rogoz...

Ngày tải lên: 07/03/2014, 02:20

... that measure- ment of acid phosphatase activity was the best estima- tion of the mRNA abundance in our systems, and from here on we use the ratio of acid phosphatase activities as an indicator ... presence of sublethal amounts of MPA. (B) mRNA levels of the transcription units and strains ana- lyzed in (A) cultured in the absence of MPA. The relative values of t...

Ngày tải lên: 07/03/2014, 12:20

... about the characters who speak and what they said at each dialogue turn. On the other hand, context elements contain all the additional information (explanations and descriptions) appearing ... are automatically replaced by the placeholders <self-name> and <other-name>, res- pectively. In the case of a mature dialogue, when there are more terms into the voca...

Ngày tải lên: 07/03/2014, 18:20

... fragment from the human trypsinogen prepro sequence was amplified from human pancreatic cDNA using the primer set (forward, CCCA AGCTTACCATGAATCTACTCCTGAT; reverse, GTTG GTACCTTGTCATCATCATCAAAGG), and ... 7 (TACACACCCTGACCCGCATC) and 6 as template. Sequence analysis The sequence of the cDNA was analyzed using genetyx software (Software Development Co. Ltd, Tokyo, Japan). A nove...

Ngày tải lên: 16/03/2014, 23:20

... 47th Annual Meet- ing of the Association for Computational Linguistics and the 4th International Joint Conference on Natu- ral Language Processing of the Asian Federation of Natural Language Processing ... from the same class. Though PoS induction was not their aim, this restriction is largely validated by empirical analysis of treebanked data, and moreover conveys the sig...

Ngày tải lên: 17/03/2014, 00:20