Báo cáo khoa học: A unique binding epitope for salvinorin A, a non-nitrogenous kappa opioid receptor agonist docx
Tài liệu Báo cáo khoa học: Is ATP binding responsible for initiating drug translocation by the multidrug transporter ABCG2? docx
... metal oxo- anion vanadate serves as a transition state mimic, exploiting its chemical similarity to phosphate. Thus, ATP and vanadate generate an ADP-vanadate struc- ture mimicking the transition ... & Callaghan R (2008) Resistance to chemo- therapy in cancer: a complex and integrated cellular response. Pharmacology 81, 275–300. 2 Ambudkar SV, Dey S, Hrycyna CA, Ramachandra M, Pastan...
Ngày tải lên: 18/02/2014, 18:20
Báo cáo khoa học: A unique binding epitope for salvinorin A, a non-nitrogenous kappa opioid receptor agonist docx
... McCurdy CR, Sufka KJ, Warnick JE & Nieto MJ (2005) Salvinorin A, a kappa opioid receptor agonist, is an ultrashort acting analgesic. International Narcotics Research Conference Abstracts M23. 5 ... A unique binding epitope for salvinorin A, a non-nitrogenous kappa opioid receptor agonist Brian E. Kane 1 , Marcelo J. Nieto 2 , Christopher R. McCurdy 2...
Ngày tải lên: 30/03/2014, 11:20
Tài liệu Báo cáo khoa học: "An Efficient Parallel Substrate for Typed Feature Structures on Shared Memory Parallel Machines" docx
... the name- concatenator-sub which had asked to do the job. Note that the name-concatenator-sub can ask any of the existing CSAs. All CSAs can basi- cally perform concatenation in parallel and ... its heap: • shared heap • local heap A local heap is used for temporary operations during the computation inside a CSA. A CSA cannot read/write local heap of other CSAs. A shared he...
Ngày tải lên: 20/02/2014, 18:20
Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf
... 906–911. 7 Park S, Gakh O, O’Neill HA, Mangravita A, Nichol H, Ferreira GC & Isaya G (2003) Yeast frataxin sequentially chaperones and stores iron by coupling protein assembly with iron oxidation. ... 31340–31351. 8 Park S, Gakh O, Mooney SM & Isaya G (2002) The ferroxidase activity of yeast frataxin. J Biol Chem 277, 38589–38595. 9 Cavadini P, O’Neill HA, Benada O & Isaya G (20...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Mapping of the epitope of a monoclonal antibody protecting plasminogen activator inhibitor-1 against inactivating agents pptx
... inhibitory activity to Mab-1: Q57/7 3A, Q59/7 5A, Q61/7 7A, K67/8 3A, K106/12 5A, Q109/12 8A, R302/31 3A, F304/31 5A, Q305/31 6A, T309/31 9A, D313/32 3A, Q314/ 32 4A, E315/32 5A, P316/32 6A, K325/33 5A. 1676 J. ... indistinguishable from wt with respect to the a nity to Mab-1: Q57/7 3A, Q59/7 5A, Q61/7 7A, K67/8 3A, K106/12 5A, Q109/12 8A, D299/31 0A, R302/31 3A, F304...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo khoa học: Phosphorylation-dependent binding of human transcription factor MOK2 to lamin A⁄C pot
... p38MAPK signaling modules & transcription factors. Proc Natl Acad Sci USA 99, 14189–14194. 12 Ito M, Yoshioka K, Akechi M, Yamashita S, Takama- tsu N, Sugiyama K, Hibi M, Nakabeppu Y, Shiba ... (2005) Aurora -A site specificity: a study with synthetic peptide substrates. Biochem J 390, 293–302. 20 Ohashi S, Sakashita G, Ban R, Nagasawa M, Matsuzaki H, Murata Y, Taniguchi H, Shima H, Fur...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx
... phosphorylation; n-DNA, nuc- lear DNA; mtDNA, mitochondrial DNA; NRF, nuclea r respiratory factor; RACE, rapid amplification of cDNA ends; AEL, after egg laying; UTR, untranslated region; DPE, downstream ... promoter element. *Present a ddress: Departamento de Anatomı ´ a y Biologı ´ aCelular, Facultad de Medicina, Universidad de Cantabria, Santander, Spain. (Received 2 June 2004, revised...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf
... 1.35-m M phosphatase substrate (SIGMA 104Ò, Sigma-Aldrich, Bornem, Belgium) solution was added and the absorbance was measured after 30 and 60 min at 405 nm on a SPECTRAmax PLUS 384 microplate reader system ... with increasing pH. OD was measured 60 min after adding the substrate. (B) Inhibition ELISA with monosubstituted HNE peptides. Each Cys was replaced by an Ala (C38 1A, C38 6A, C39...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Thermosynechoccus elongatus DpsA binds Zn(II) at a unique three histidine-containing ferroxidase center and utilizes O2 as iron oxidant with very high efficiency, unlike the typical Dps proteins ppt
... Havukainen H, Haataja S, Kauko A, Pulliainen AT, Salminen A, Haikarainen T, Finne J & Papageorgiou AC (2008) Structural basis of the zinc- and terbium- mediated inhibition of ferroxidase activity ... DpsA-Te1 (5¢-GGAGTATCGT CATATGACGACCAGTGCATTG-3¢) and DpsA-Te2 (5¢-CAGACGACACA AAGCTTCACC TTG-3¢). The NdeI and HindIII restriction sites are under- lined. The amplified fragment (530 bp)...
Ngày tải lên: 15/03/2014, 09:20
Báo cáo khoa học: The unique pharmacology of the scorpion a-like toxin Lqh3 is associated with its flexible C-tail pdf
... construct HA-Lqh3 using the pET-14b vector as template DNA. Primer 1, 5¢ - GGCAGCCATATGTGTAATTGTAAGGCA CCAGAAACTGCACTTTGCGC-3¢, was designed to add a sequence encoding Apamin and a linker cleavable ... with var- ious C-tail conformations (Fig. 7). Such a mechanism may also rationalize the broad-range potency of this toxin on insect as well as mammalian peripheral and brain Na v s [5,16,...
Ngày tải lên: 23/03/2014, 09:20