1. Trang chủ
  2. Luận Văn - Báo Cáo

Báo cáo khoa học: Identification and characterization of a collagen-induced platelet aggregation inhibitor, triplatin, from salivary glands of the assassin bug, Triatoma infestans ppt

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... 3¢-RACE Zf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACE Zf5¢stat6-R1 CCATGTCTGCAGATGGTCGAGG 5¢-RACE Zf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACE Zf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACE Zf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC ... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACE Zf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACE Zf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACE Zffoxp3-F1 GGAACACACAGAGGGGATGATA Initial...
Ngày tải lên : 16/02/2014, 09:20
  • 20
  • 689
  • 0
  1. Luận Văn - Báo Cáo
  2. Báo cáo khoa học
Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf
... P (2000) The transcriptional co-activator P ⁄ CAF potenti- ates TGF-beta ⁄ Smad signaling. Nucleic Acids Res 28, 4291–4298. 39 Kahata K, Hayashi M, Asaka M, Hellman U, Kitagawa H, Yanagisawa J, Kato ... DeMarco R, Martins EA, Guimaraes PE, Ojopi EP, Paquola AC, Piazza JP, Nishiyama MY Jr, Kitajima JP, Adamson RE et al. (2003) Transcriptome analysis of the acoelomate human parasite Schis...
Ngày tải lên : 18/02/2014, 16:20
  • 19
  • 653
  • 0
  1. Luận Văn - Báo Cáo
  2. Báo cáo khoa học
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot
... [21]. A SmNR1 specific probe of 497 bp was produced by PCR amplification with TOPO 2.1-SmNR1 as a template (forward primer: 5¢-ATTTCAGAAGTTGAAC AAACACAC-3¢, reverse primer: 5¢-AAGATGGTATT GAAGATGATGGTTGA-3¢), ... 2006 The Authors Journal compilation ª 2006 FEBS 401 DR1: 5¢-CCGTAAGGTCACAGGTCACTCG-3¢, DR2: 5¢-CCGTAAGGTCACAAGGTCACTCG-3¢,DR3:5¢-CCG TAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAA G...
Ngày tải lên : 07/03/2014, 11:20
  • 16
  • 542
  • 0
  1. Luận Văn - Báo Cáo
  2. Báo cáo khoa học
Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf

Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf
... sequences are part of the basal transcriptional apparatus, such as the TATA box, centered at )27 from the transcriptional start site, and the BRE motif, targets for the general transcrip- tion factors ... 25–29. 12 Kawakami R, Sakuraba H, Kamohara S, Goda S, Kawarabayasi Y & Ohshima T (2004) Oxidative stress response in an anaerobic hyperthermophilic archaeon: presence of...
Ngày tải lên : 07/03/2014, 12:20
  • 11
  • 565
  • 0
  1. Luận Văn - Báo Cáo
  2. Báo cáo khoa học
Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot

Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot
... with the primers 5¢-GTTCC TGAGCAAAGTCTTCAATG-3¢ and 5¢-GGAATTCAG TGGAAAAACTTTACAT-3¢ for XPR130, the primers 5¢-GTTCCTGAGCAAAGTCTTCAATG-3¢ and 5¢-GG AATTCAGTGGAAAAACTTTACAT-3¢ for XN73, and the ... 3¢-Splice acceptor 1 158 AACGAGgtaggc 35209 ttacagGTTTCT 2a 2435 ATCAAGgtaaga 16864 ctgcagGCTGTG 2b 383 ACACAGgtttga 3629 ttttagATTCAA 3 267 GCAAAGgtaatg 13760 ttgcagGTCTGT 4 104 GAGA...
Ngày tải lên : 08/03/2014, 08:20
  • 12
  • 507
  • 0
  1. Luận Văn - Báo Cáo
  2. Báo cáo khoa học
Báo cáo khoa học: Identification and characterization of plasma kallikrein–kinin system inhibitors from salivary glands of the blood-sucking insect Triatoma infestans pptx

Báo cáo khoa học: Identification and characterization of plasma kallikrein–kinin system inhibitors from salivary glands of the blood-sucking insect Triatoma infestans pptx
... Morita A, Isawa H, Orito Y, Iwanaga S, Chinzei Y & Yuda M (2006) Identification and characterization of a collagen-induced platelet aggregation inhibitor, triplatin, from salivary glands of the ... Herwald et al. [11]. Assay for the effect of triafestin-1 and triafestin-2 on plasma coagulation and tenase activity The effects of triafestin-1 and...
Ngày tải lên : 16/03/2014, 05:20
  • 16
  • 411
  • 0
  1. Luận Văn - Báo Cáo
  2. Báo cáo khoa học
Báo cáo khoa học: Identification and characterization of oxidized human serum albumin A slight structural change impairs its ligand-binding and antioxidant functions pptx

Báo cáo khoa học: Identification and characterization of oxidized human serum albumin A slight structural change impairs its ligand-binding and antioxidant functions pptx
... 18, 153–158. 9 Soejima A, Matsuzawa N, Hayashi T, Kimura R, Ootsuka T, Fukuoka K, Yamada A, Nagasawa T & Era S (2004) Alteration of redox state of human serum albumin before and after hemodialysis. Blood ... Suzuki 2 and Kazuo Hirayama 2 1 Pharmaceutical Research Laboratories, Ajinomoto Co. Inc., Kawasaki, Japan 2 Institute of Life Science, Ajinomoto Co. Inc., Kawasaki, Japan...
Ngày tải lên : 16/03/2014, 13:20
  • 12
  • 479
  • 0
  1. Luận Văn - Báo Cáo
  2. Báo cáo khoa học
Báo cáo khoa học: Identification and characterization of four novel peptide motifs that recognize distinct regions of the transcription factor CP2 doc

Báo cáo khoa học: Identification and characterization of four novel peptide motifs that recognize distinct regions of the transcription factor CP2 doc
... (5¢-GAAACCATTTTGCAGCGAAAGTATACAC-3¢) for Pro ⁄ Arg to Ala ⁄ Ala mutations in bases 803–830. The two overlapping PCR fragments were mixed and added as a template in the second PCR that used 1–19 and ... Wilanowski T, Cerruti L, Zhao LL, Cunning- ham JM & Jane SM (2003) The identification and char- acterization of human Sister -of- Mammalian Grainyhead (SOM) expands the g...
Ngày tải lên : 16/03/2014, 18:20
  • 13
  • 451
  • 0
  1. Luận Văn - Báo Cáo
  2. Báo cáo khoa học
Báo cáo khoa học: Identification and characterization of novel PKA holoenzymes in human T lymphocytes pdf

Báo cáo khoa học: Identification and characterization of novel PKA holoenzymes in human T lymphocytes pdf
... polyclonal antibodies (anti-PKAacat, anti- PKAbcat and anti-PKAccat) and one monoclonal antibody (anti-Cmono) were immunoreactive to two protein bands of 40 and 47 kDa, respectively (Fig. 1B). All of ... express Ca and Cb mRNA [7] and that human immune tissues such as spleen and thymus express Cb1 and Cb2 mRNA [6]. Total RNA was isolated from human T cells, the T-cell li...
Ngày tải lên : 16/03/2014, 18:20
  • 9
  • 406
  • 0
  1. Luận Văn - Báo Cáo
  2. Báo cáo khoa học
Báo cáo khoa học: Identification and characterization of important residues in the catalytic mechanism of CMP-Neu5Ac synthetase from Neisseria meningitidis potx

Báo cáo khoa học: Identification and characterization of important residues in the catalytic mechanism of CMP-Neu5Ac synthetase from Neisseria meningitidis potx
... be of great benefit to the study of infectious and autoimmune diseases and cancers, to under- stand the pathway of sialylation in detail to enable the design and produc- tion of inhibitors and ... ¼ V max ½S K m þ½SðÞ ð2Þ where v is the initial rate, V max is the maximal rate of the reaction at saturating substrate concentration and K m is the apparent K m f...
Ngày tải lên : 22/03/2014, 21:21
  • 12
  • 463
  • 0
  1. Luận Văn - Báo Cáo
  2. Báo cáo khoa học

Xem thêm

Từ khóa: