Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

... cooperate in the activation of an enzyme. In the case of proPC1 ⁄ 3, removal of the var- ious structural and functional domains is a sequential and coordinated event culminating in removal of the CT-peptide ... cleavages of the initial preproPC1 ⁄ 3. Following removal of the signal peptide, autocatalytic cleavage occurs in the early secretory pathway at...

Ngày tải lên: 30/03/2014, 08:20

... Prm3abb; pGL3b:Prm3abb. (Primer Kin212, 5¢-dGAG A GGTACCGAGCAAGACTCTGTCTC AAA -3 , nucleo- tides )229 to )209). 3. Prm3abc; pGL3b:Prm3abc. (Primer Kin 236 , 5¢-dGAG AGGTACCCCGGAGAGGATATTTGAGCTG -3 , ... plays a key role in the maintenance of haemostasis [ 23] . TXA 2 also induces a diversity of other actions and is widely implicated as a mediator in a range of vascular,...

Ngày tải lên: 07/03/2014, 21:20

... amplification enzyme, pCDA401 as a template and the following primer pairs: for CD69NG70, 5¢-ACATATGGGCCAATACACATTC -3 and 5¢-ACAAAGCTT ATTTGTAAG GTTTGTTA CA -3 ;for CD69NV82, 5¢-ACATATGGTTT CTTCATGC ... CTTCATGC TCTG -3 and 5¢- AC AAAGCTTA TTTGTAAGG TTTGTTAC A -3 ; and for CD69NS84, 5¢-ACATATGTCATGCTCTGAGGACTGG GTT -3 and 5¢- ACAAAGCTTATTTGTAAGGTTTGTT ACA -3 . PCR products were direc...

Ngày tải lên: 16/03/2014, 04:20

... Weak organic acid stress inhibits aromatic amino acid uptake by yeast, causing a strong in uence of amino acid auxotrophies on the phenotypes of membrane transporter mutants Bettina E. Bauer 1, *, ... indicated by the initial plating (Fig. 1), underlining the importance of progressing from initial plating assays (Figs 1 3) to detailed studies of growth kinetics for any full...

Ngày tải lên: 23/03/2014, 21:20

... cuagcuaauaaauuaAGGAGGauuuaaauAUGAGUGAAUCACAAGCCc DR-C cuagcuaauaaauuaAGGAGGauuuaaauAUGAAAAAGGAGUCGACUc DR-D cuagcuaauaaauuaAGGAGGauuuaaauAUGACCGAGGGUGUUUCCc 3A 2A DR -A 3A / 2A 0.16 0.08 0 .37 0.170 .39 0.210.660 .31 CVR40DMG1655CVR40DMG1655CVR40DMG1655CVR40DMG1655 DR-B DR-C DR-D Fig. ... ksg/MG1655 pSS101 3A TIR cuagcuaauaaauuaAGGAGGauuuaaauAUGaaaccucuagagucgacu 2A TIR cggauaacaa...

Ngày tải lên: 29/03/2014, 09:20

... permeability of the endothelial cell monolayer in vitro, indicating that they can modulate and enhance vascular perme- ability, a hallmark of in ammation [11]. It has been known for many years that 15-LO-1 ... mediators formed via the 15-LO-1 pathway can induce in ammatory reactions and in uence the immune system in man. There are also indications, however, that 15-LO-1 ma...

Ngày tải lên: 30/03/2014, 04:20

... reactions that would otherwise obscure the labelling pattern. Thus, an early attempt of combinatorial labelling in vivo had to exclude gluta- mine, glutamate, asparagine and aspartate from the labelling ... peaks are obtained in this way so long as the corresponding amino acid pairs are unique in the amino acid sequence. The drawback of this approach is the significantly...

Ngày tải lên: 07/03/2014, 12:20

... nhan tinh the thai, rat gan giii ma ngUdi dpc tffng tha'y xay ra xung quanh. Khi lan sdng Au boa tran sang nUdc ta ndi chung, vung da't Nam Bd ndi rieng da tao ra sU phan hoa giai ... va bi ten ban lam phan. Thay bi mdt a giang hd lffa gat; vd thay vi dau budn ma quyen sinh. Thay VD bd'i ban, phat dien va che't tham Cau chuyen de cao dao dffc gia dinh, gia di...

Ngày tải lên: 23/03/2014, 03:20

... Hayakawa, A. , Suzuki, H., Miyata, T., Kurokawa, K., Hotta, Y., Ishikawa, N. & Naka- shima, I. (2000) 4-Hydroxynonenal induces a cellular redox status- related activation of the caspase cascade ... minimal essential medium containing 20% fetal bovine serum and 50 lgÆmL )1 gentamicin at 37 °Cin5%CO 2 .Humanlung fibroblast cell line, CCL-75, obtained from ATCC (Man- assas, VA, USA) w...

Ngày tải lên: 30/03/2014, 13:20

Ngày tải lên: 27/10/2012, 10:29