Báo cáo khoa học: DNA binding and partial nucleoid localization of the chloroplast stromal enzyme ferredoxin:sulfite reductase pptx
... studies of the role of SiR in chloroplast nucleoids, SiR was suggested to repress DNA synthesis [26] and transcription [27] within nucleoids. Relaxing the DNA compaction of nucleoids by release of ... of recombinant PsSiR and 40-mer or 20-mer dsDNA were mixed, and then the mixtures were electrophoresed. The intensity of the shifted bands (complexes of DNA...
Ngày tải lên: 30/03/2014, 08:20
... (binding of the labelled psbA probe only 40% of that in the control) in the presence of the mutant factor (300Q/H). Hence this sigma mutant counteracted the effect of M-10 T/A. None of the other ... None of the controls consisting of the DNA probe alone (lane 1), or of probe plus recombinant proteins (lanes 4–7), gave a labelled band at the position of...
Ngày tải lên: 31/03/2014, 07:20
... C-terminal regions of the enzyme, and the NADPH -binding domain (residues 109–323) consisting of the central part of the polypeptide chain [8]. A small two-stranded b-sheet links the two domains. ... the family of glutathione reductase [8], of which FprA is a member. The FprA monomer consists of two domains: the FAD -binding domain (residues 2–108 and 324–...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Substrate preference and phosphatidylinositol monophosphate inhibition of the catalytic domain of the Per-Arnt-Sim domain kinase PASKIN ppt
... against S6 and the GST-tag. (C) Immunoblot analysis of the phosphorylation status of p70S6K and S6 in Paskin + ⁄ + and Paskin ) ⁄ ) MEFs. (D) Immu- noblot analysis of the phosphorylation status of p70S6K ... phosphorylate three translation factors and two enzymes involved in the regulation of glycogen and trehalose synthesis, thereby coordinately controlling transl...
Ngày tải lên: 06/03/2014, 00:21
Báo cáo khoa học: Halogenated benzimidazoles and benzotriazoles as inhibitors of the NTPase/helicase activities of hepatitis C and related viruses ppt
... inhi- bition of the unwinding reaction by the HCV enzyme was observed when the DNA substrate concentration exceeded 15 p M (not shown). The responses of the helicase activities of the other three enzymes ... at )70 °C. The areas of the gels corresponding to the released strand and to the nonunwound substrate were cut out and 32 P radioactivity counted. Alte...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: Ibuprofen binding to secondary sites allosterically modulates the spectroscopic and catalytic properties of human serum heme–albumin doc
... 10 )1 s )1 ). Ibuprofen binding to tHSA–heme-Fe(II)-NO Figure 4 shows the binding isotherm for ibuprofen binding to tHSA–heme-Fe(II)-NO. Analysis of the dependence of the molar fraction of the ibuprofen- bound ... k þ off ð7Þ where k off(2) and k off(3) indicate values of k off occurring at K 2 < [ibuprofen] < K 3 , and at K 2 < K 3 < [ibuprofen], respect...
Ngày tải lên: 06/03/2014, 01:20
Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc
... together, these data confirm the specificity of the SenR -binding sites and corroborate the assumption that phosphorylation of SenR by SenSP alters its DNA- binding characteristics. Discussion The ... GACGGAATTCAGGATCGGTTCCGG (located upstream of hbpS and ending at the 5 ¢-end of the inverted repeat) H REcofor GCTCGAATTCCGTCCCGTCGCCGG (located upstream of hbpS an...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: GTP binding and hydrolysis kinetics of human septin 2 pot
... after the completion of most of the studies described herein. Given the conserved nature of this residue we there- fore mutated the residue back to arginine and found that none of the properties of ... shown in the inset with the ratio of the concentration of bound GTPcS over the concentration of SEPT2 divided by the free GTPcS ([b] ⁄ [SEPT2] ⁄ [f] – y ax...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Ligand binding and antigenic properties of a human neonatal Fc receptor with mutation of two unpaired cysteine residues docx
... Søren Andersen and Professor Peter Roepstorff (University of Southern Denmark, Odense) for recording the presented MALDI-TOF ⁄ TOF spectrum, and Tove Olafsen and Anna M. Wu (University of California ... generated that recognized either of the ligand -binding sites located in the a2 domain. Thus, the antigenic proper- ties of the HC in this region are sufficiently simil...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Alizarine derivatives as new dual inhibitors of the HIV-1 reverse transcriptase-associated DNA polymerase and RNase H activities effective also on the RNase H activity of non-nucleoside resistant reverse transcriptases pot
... to other RT pockets and that the binding stoichiometry of the compounds to RT could also be different according to the RT mutations and the relative compound-RT affinities. The position of the ... correct binding modes of compounds. The enzyme was divided into five boxes of the same size (50 · 50 · 50 A ˚ ) covering overall the whole enzyme and the comp...
Ngày tải lên: 22/03/2014, 16:20