Báo cáo khoa học: Structural and functional insights into Erwinia carotovora L-asparaginase ppt

... L-asparaginase A. C. Papageorgiou et al.4316 FEBS Journal 275 (2008) 4306–4316 ª 2008 The Authors Journal compilation ª 2008 FEBS Structural and functional insights into Erwinia carotovora L-asparaginase Anastassios ... both EcAII and ErA.To gain further insights into EwA and to assess itssuitability as a drug candidate, we have determined thecrystal structure of the enzyme in the presence of Asp and carried ... catalysis. Crystal structure of Erwinia chrysanthemi L-asparaginase with bound L-aspartate. FEBS Lett 328,275–279.A. C. Papageorgiou et al. Erwinia carotovora L-asparaginase FEBS Journal 275...

Báo cáo khoa học: Structural and thermodynamic insights into the binding mode of ﬁve novel inhibitors of lumazine synthase from Mycobacterium tuberculosis pptx

... resi-dues 58–61 from loop connecting b3 and a and residues 81–87 from loop connecting b4 and a3from one subunit and the residues 114 and 128–141from b5 and a4- and a5-helices from the neigh-bouring ... ¼Hð1ÀHÞ½X and Xt¼ [X] + nQMt, where Kis the binding constant; n, number of sites; Mt, total con-centration of macromolecule in V0;Xt and [X] are total and free concentrations of ligand, and ... coloured in brown (A- and F-subunits), pink (B- and J-subunits), light brown (C- and I-subunits), light pink (D- and H-subunits) and beige (E- and G-subunits). The activesites, located between...

Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

... CTGGATCCTCGGGCGAGCTCAGCAAC and GACGGCGGCCGCTCAGGGCAGGCTAGCAATGTCT were used. The PCR product wascloned into the vector pQTEV (GenBank AY243506) usingBamHI and NotI restriction sites and introduced into Escherichia ... composedmainly of a helices (Figs 1 and 2). The core of Iba2 is apair of EF-hand motifs, denoted as EF-hands 1 and 2,each consisting of two a helices (aA, aB and aC, aD,respectively) ﬂanking ... topology of Iba2 shows structural simi-larities to classical EF-hand proteins. The second pairof EF-hands in calmodulin (PDB code 1CLL) [19] and the second pair of EF-hands in troponin C (PDB...

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... HPRT and hypoxanthine. (C) PRTFDC1 and guanine. (D) HPRT and guanine.Table 2. Km and Vmaxvalues for Hx and G in the presence of 1 mM PRPP, determined using the DE-81 ﬁlter paper assay and ... extends into a b-ribbon with b5,stabilizing loop II. The hood domain is mainly builtup by residues from the C-terminus and consists of atwo-stranded anti-parallel b-sheet composed of b2 and b9 and ... [10].The structural characterization of numerous com-plexes of the human HPRT and several bacterial and protozoan HPRTs have been undertaken [13–17]. Thestructure of human HPRT can be divided into...

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... between R81 and P82 and between G90 and I91. A similar cis peptidebetween G93 and V94 is found in Tm SurE also.Overall structural features of the proteinSt SurE is an aba sandwich protein and adopts ... thesecondary structural elements of St SurE. Arrows representb-strands, while small and large cylinders represent 310-helices and a-helices, respectively. Numbers shown indicate the starting and ending ... arerepresented by pink, cyan, blue and yellow, respectively. The tetra-meric interactions are between the subunits A and C, and B and D,by way of the b hairpins and the loop, which connects b2tob3(boxed).Structure...

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... D and E + F), (b) a few hydrogenbonds, and a hydrophobic interaction between A + C,B + E and D + F, and (c) electrostatic forces in thecentral channel of the hexamer between B, C and F, and ... water molecule ﬁx-ing the three lysines from the B, C and F subunits, and there is no direct interaction between subunits A and F, B and D, or C and E.A phosphate ion was found in the donor site ... The mutant enzymes, F133N and F133A, were expressed, puriﬁed and characterized.With 1 mm UMP and ATP as substrates, the activitiesof F133N and F133A were only 50 and 20% of thatof the wild-type...

Tài liệu Báo cáo khoa học: Structural and functional speciﬁcities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

... PDGF-c (exons 5 and 6) and PDGF-d(exons 6 and 7) encoding the cystine knot motifsresemble the corresponding exons in the PDGF-a and -b (exons 4 and 5) genes. Both in PDGF-a and -b, exon6 encodes ... disulﬁdebridges in PDGF-C to consist of Cys250 and 294,Cys280 and 335, and Cys287 and 337, and the inter-monomeric bonds to consist of Cys274 and 286 [57].At present, analysis of PDGF ⁄ VEGF ... -b on chromosomes 7 and 22[17,18], and PDGF-c and -d on chromosomes 4 and 11[19], respectively. The genomic organization of the pdgfgenes is quite similar, although PDGF-c and -d genesare signiﬁcantly...

Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

... distinguished. Helices B,E, F and H, arranged in an up -and- down topology,form the structural core, whereas the short helices C,D and G on one side, and A, I and J on the other,represent types ... MINIREVIEW Structural and functional aspects of unique type IVsecretory components in the Helicobacter pyloricag-pathogenicity islandLaura Cendron1 and Giuseppe Zanotti21 ... moleculeinvolving a-helix A, the nearby loop, the ﬁrst and lastturns of helices E and F, and the C-terminus helices I and J. In addition, there is a lysine-rich N- and C-ter-minus, in accordance with the...

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

... FEBS Structural and functional roles for b-strand 7 in thea-crystallin domain of p26, a polydisperse small heat shockprotein from Artemia franciscanaYu Sun, Svetla Bojikova-Fournier and Thomas ... dimers, with mono-mers A and B in dimer 1 and C and D in dimer 2(Fig. 8). The a-crystallin domain of each monomer iscomposed of nine b-strands (labeled b2–b10), with theb6 strand situated in a large ... formationdepends upon contact of b-strand 10 from the C-ter-minal extensions of monomers A and D withb-strands 4 and 8 in the a-crystallin domain ofmonomers C and B, respectively (Fig. 8). A more...

Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

... Cdc23p and Cdc27p form a complexessential for mitosis. EMBO J 13, 4321–4328.Domain function of Pex1p and Pex6p I. Birschmann et al.58 FEBS Journal 272 (2005) 47–58 ª 2004 FEBS Structural and functional ... Targeting and trans-location of newly synthesized peroxisomal matrix pro-teins requires ATP and depends on peroxisomaltargeting signals [10], PTS1 and PTS2, and theircognate receptors Pex5p and ... Here we conﬁrm and extend earlier studies of these AAA-peroxins and givea further detailed functional analysis of their cassettestructure and interaction.The interaction of Pex1p and Pex6p involvestheir...

Xem thêm