Báo cáo khoa học: Structural and functional insights into Erwinia carotovora L-asparaginase ppt

Báo cáo khoa học: Structural and functional insights into Erwinia carotovora L-asparaginase ppt

Báo cáo khoa học: Structural and functional insights into Erwinia carotovora L-asparaginase ppt

... L-asparaginase A. C. Papageorgiou et al. 4316 FEBS Journal 275 (2008) 4306–4316 ª 2008 The Authors Journal compilation ª 2008 FEBS Structural and functional insights into Erwinia carotovora L-asparaginase Anastassios ... both EcAII and ErA. To gain further insights into EwA and to assess its suitability as a drug candidate, we have determined the crystal structure of...

Ngày tải lên: 30/03/2014, 04:20

11 410 0
Báo cáo khoa học: Structural and thermodynamic insights into the binding mode of five novel inhibitors of lumazine synthase from Mycobacterium tuberculosis pptx

Báo cáo khoa học: Structural and thermodynamic insights into the binding mode of five novel inhibitors of lumazine synthase from Mycobacterium tuberculosis pptx

... resi- dues 58–61 from loop connecting b3 and a and residues 81–87 from loop connecting b4 and a3 from one subunit and the residues 114 and 128–141 from b5 and a4- and a5-helices from the neigh- bouring ... ¼ H ð1ÀHÞ½ X and X t ¼ [X] + nQM t , where K is the binding constant; n, number of sites; M t , total con- centration of macromolecule in V 0 ;X t and [X] are total and...

Ngày tải lên: 07/03/2014, 11:20

15 439 0
Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

... CTGGATCCTCGGGCGA GCTCAGCAAC and GACGGCGGCCGCTCAGGGCAG GCTAGCAATGTCT were used. The PCR product was cloned into the vector pQTEV (GenBank AY243506) using BamHI and NotI restriction sites and introduced into Escherichia ... composed mainly of a helices (Figs 1 and 2). The core of Iba2 is a pair of EF-hand motifs, denoted as EF-hands 1 and 2, each consisting of two a helices (aA, a...

Ngày tải lên: 16/03/2014, 06:20

14 546 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... HPRT and hypoxanthine. (C) PRTFDC1 and guanine. (D) HPRT and guanine. Table 2. K m and V max values for Hx and G in the presence of 1 mM PRPP, determined using the DE-81 filter paper assay and ... extends into a b-ribbon with b5, stabilizing loop II. The hood domain is mainly built up by residues from the C-terminus and consists of a two-stranded anti-parallel b-sheet composed...

Ngày tải lên: 15/02/2014, 01:20

11 770 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... between R81 and P82 and between G90 and I91. A similar cis peptide between G93 and V94 is found in Tm SurE also. Overall structural features of the protein St SurE is an aba sandwich protein and adopts ... the secondary structural elements of St SurE. Arrows represent b-strands, while small and large cylinders represent 3 10 -helices and a-helices, respectively. Numbers show...

Ngày tải lên: 18/02/2014, 14:20

10 554 0
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... D and E + F), (b) a few hydrogen bonds, and a hydrophobic interaction between A + C, B + E and D + F, and (c) electrostatic forces in the central channel of the hexamer between B, C and F, and ... water molecule fix- ing the three lysines from the B, C and F subunits, and there is no direct interaction between subunits A and F, B and D, or C and E. A phosphate ion was fou...

Ngày tải lên: 18/02/2014, 16:20

12 657 0
Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

... PDGF-c (exons 5 and 6) and PDGF-d (exons 6 and 7) encoding the cystine knot motifs resemble the corresponding exons in the PDGF-a and -b (exons 4 and 5) genes. Both in PDGF-a and -b, exon 6 encodes ... disulfide bridges in PDGF-C to consist of Cys250 and 294, Cys280 and 335, and Cys287 and 337, and the inter- monomeric bonds to consist of Cys274 and 286 [57]. At present...

Ngày tải lên: 19/02/2014, 07:20

19 558 0
Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

... distinguished. Helices B, E, F and H, arranged in an up -and- down topology, form the structural core, whereas the short helices C, D and G on one side, and A, I and J on the other, represent types ... MINIREVIEW Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island Laura Cendron 1 and Giuseppe Zanotti 2...

Ngày tải lên: 06/03/2014, 00:21

9 496 0
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

... FEBS Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana Yu Sun, Svetla Bojikova-Fournier and Thomas ... dimers, with mono- mers A and B in dimer 1 and C and D in dimer 2 (Fig. 8). The a-crystallin domain of each monomer is composed of nine b-strands (labeled b2–b10), with the b6 stran...

Ngày tải lên: 07/03/2014, 12:20

15 516 0
Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

... Cdc23p and Cdc27p form a complex essential for mitosis. EMBO J 13, 4321–4328. Domain function of Pex1p and Pex6p I. Birschmann et al. 58 FEBS Journal 272 (2005) 47–58 ª 2004 FEBS Structural and functional ... Targeting and trans- location of newly synthesized peroxisomal matrix pro- teins requires ATP and depends on peroxisomal targeting signals [10], PTS1 and PTS2, and thei...

Ngày tải lên: 07/03/2014, 16:20

12 584 0
w