Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

... the action of the ataxia telangiectasia mutated (ATM) ⁄ ataxia telangiectasia and RAD53 related (ATR) kinases at the site of DNA damage may decrease the kinase ⁄ phosphatase ratio and allow the ... 2008 The Authors Journal compilation ª 2008 FEBS 4221 Characterization of the role of a trimeric protein phosphatase complex in recovery from cispla...

Ngày tải lên: 30/03/2014, 04:20

11 362 0
Báo cáo khoa học: Studies on the role of the receptor protein motifs possibly involved in electrostatic interactions on the dopamine D1 and D2 receptor oligomerization pdf

Báo cáo khoa học: Studies on the role of the receptor protein motifs possibly involved in electrostatic interactions on the dopamine D1 and D2 receptor oligomerization pdf

... lg of DNA per 100 mm dish and 2 lg of DNA per 30 mm dish. The ratio of DNA coding donor to DNA coding acceptor was 1 : 1 or 1 : 2. Membrane preparation and radioligand binding assay For binding ... (two each) from the arginine-rich epitope (217RRRRKR222) of the third intra- cellular loop were exchanged (D 2 R1: 217AARRKR222, D 2 R2: 217AAAAKR222, D 2 R3: 217AAAAAA222),...

Ngày tải lên: 07/03/2014, 03:20

16 567 0
Báo cáo khoa học: "Re-evaluating the Role of B LEU in Machine Translation Research" ppt

Báo cáo khoa học: "Re-evaluating the Role of B LEU in Machine Translation Research" ppt

... 2005). The remaining six entries were all fully automatic machine translation sys- tems; in fact, they were all phrase-based statistical machine translation system that had been trained on the same ... already stated that Kharazi’s state- ments to the conference because of the Jor- danian King Abdullah II in which he stood accused Iran of interfering in Iraqi affairs. n-gram...

Ngày tải lên: 17/03/2014, 22:20

8 455 0
Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx

Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx

... 764pA::GUS ) 234AF AAAAAGCAGGCTGAGAAATCTATGGAATAAATAAAAATTAGGG b ) 234pA::GUS PromAR AGAAAGCTGGGTCGATGTTTCACTGAAACATTAATAGATATTC b,c All chimeric cardosin A constructs except pADi::GUS PromARDi AGAAAGCTGGGTCGATGTTTCATCACGTGTTATTTGATGGAAGCAATG b,c,d pADi::GUS ) ... 2912pA::GUS and pADi::GUS ) 1792AF AAAAAGCAGGCTTGCTGTTCTAAGTGTACTAGCTGGA b ) 1792pA::GUS ) 1263AF AAAAAGCAGGCTCAAATTAAATCGACGGTT...

Ngày tải lên: 30/03/2014, 09:20

17 360 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... respiratory chain, the assistance of specific chaperone proteins is also required. The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc 1 intermediate [28,29] ... present in comparable amounts in both yeast strains. Therefore, the reason for the disap- pearance of the bc 1 dimer in the yeast strain in wh...

Ngày tải lên: 18/02/2014, 08:20

15 640 0
Tài liệu Báo cáo khoa học: Looking for the ancestry of the heavy-chain subunits of heteromeric amino acid transporters rBAT and 4F2hc within the GH13 a-amylase family ppt

Tài liệu Báo cáo khoa học: Looking for the ancestry of the heavy-chain subunits of heteromeric amino acid transporters rBAT and 4F2hc within the GH13 a-amylase family ppt

... men- tioning that, especially in higher animals (mammals and also in frogs and fishes), an aspartate (aspartic acid 248 in human 4F2hc; aspartic acid 380 in Fig. 1 as both the N-terminal and transmembrane ... domain, including domain B and the C-terminal domain C for rBAT proteins (669 residues on average); (b) the cata- lytic TIM barrel domain, including domain B and the C-ter...

Ngày tải lên: 18/02/2014, 13:20

14 565 0
Tài liệu Báo cáo khoa học: Insights into the structure of plant a-type phospholipase D Susanne Stumpe, Stephan Konig and Renate Ulbrich-Hofmann ¨ ppt

Tài liệu Báo cáo khoa học: Insights into the structure of plant a-type phospholipase D Susanne Stumpe, Stephan Konig and Renate Ulbrich-Hofmann ¨ ppt

... with the latter being dominant. The fluorescence and near-UV CD spectra point to tight packing of the aromatic residues in the core of the protein. From the near-UV CD signals and activity data as ... members of the PLD superfamily. However, there is low similar- ity in the remaining parts of the molecules. Most mam- malian PLDs contain a PX and a PH domain...

Ngày tải lên: 19/02/2014, 02:20

11 751 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

... Kaneko 1 , Yuanying Ding 1 , Kazuhiro Ogawa 2, *, Miki Yoshizawa 1 , Masaki Kawamura 1 , Kazuhisa Takeda 1 , Tadashi Yoshida 3 and Shigeki Shibahara 1 1 Department of Molecular Biology and Applied ... 1162–1168. 13 Nakayama M, Takahashi K, Kitamuro T, Yasumoto K, Katayose D, Shirato K, Fujii-Kuriyama Y & Shiba- hara S (2000) Repression of heme oxygenase-1 by hypoxia in vascular endo...

Ngày tải lên: 19/02/2014, 06:20

12 622 0
Tài liệu Báo cáo khoa học: Fatty acid synthesis Role of active site histidines and lysine in Cys-His-His-type b-ketoacyl-acyl carrier protein synthases ppt

Tài liệu Báo cáo khoa học: Fatty acid synthesis Role of active site histidines and lysine in Cys-His-His-type b-ketoacyl-acyl carrier protein synthases ppt

... Three assays were carried out on the purified enzymes. (a) The acyl transferase assay measures the ability of a KAS protein to accept a fatty acid substrate from the ACP. To 48 lL con- taining 50 ... start of the 10 min reaction. (B) The bulky and acidic mutant proteins compared with the inactive K32 8A protein. Lane 1 represents the amount of labeled substrate...

Ngày tải lên: 19/02/2014, 08:20

16 451 0
Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate specificity by replacement of Asn149 with Asp docx

Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate specificity by replacement of Asn149 with Asp docx

... agmatinase activity of the Asn149Asp vari- ant, it is clear that the interactions of arginase II with l-arginine and agmatine are greatly altered by replace- ment of this residue with aspartate. ... complex [9]. Certainly, if an interaction between Asn149 and the a- carboxylate group of arginine were also operative for arginase II, both the lack of arginase activity as we...

Ngày tải lên: 20/02/2014, 02:21

9 652 0
Từ khóa:
w