Báo cáo khoa học: Biosynthesis of D-arabinose in mycobacteria – a novel bacterial pathway with implications for antimycobacterial therapy pdf

Báo cáo khoa học: Biosynthesis of D-arabinose in mycobacteria – a novel bacterial pathway with implications for antimycobacterial therapy pdf

Báo cáo khoa học: Biosynthesis of D-arabinose in mycobacteria – a novel bacterial pathway with implications for antimycobacterial therapy pdf

... 2709 REVIEW ARTICLE Biosynthesis of D-arabinose in mycobacteria – a novel bacterial pathway with implications for antimycobacterial therapy Beata A. Wolucka Laboratory of Mycobacterial Biochemistry, Institute ... galactan backbone. The arabinan consists of an inner linear region of Araf-(1 fi 5) -a- Araf and of branched non-reducing terminal Ara6 motifs...

Ngày tải lên: 30/03/2014, 04:20

21 572 0
Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc

Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc

... procedures Materials and cell lines The mAbs V.1 and V.5 ag ainst GPV, ALMA.12 against GPIba, ALMA.16 against GPIX and RAM.1 against GPIbb, were developed in our laboratory [19]. CHO cell lines CHO-K1 and CHO-DUK ... [NaCl/P i containing 0.2% (w/v) BSA and 1% (v/v) goat serum]. CHO/GPIb–V–IX cells were incubated for 45 min at room temperature with the mAb V.1 in blocking solution, was...

Ngày tải lên: 23/03/2014, 13:20

7 364 0
Báo cáo khoa học: Biosynthesis of riboflavin in Archaea 6,7-Dimethyl-8-ribityllumazine synthase of Methanococcus jannaschii pdf

Báo cáo khoa học: Biosynthesis of riboflavin in Archaea 6,7-Dimethyl-8-ribityllumazine synthase of Methanococcus jannaschii pdf

... 5¢- GGAGAAATTAACCATGGTATTGATGGTAAATCTTGG-3¢ MJ-RibE-2 BamHI 5¢- TTCTTTGGAAGGGATCCAATTTCATAAAAATTT-3¢ MJ-RibE-3 EcoRI 5¢- ACACAGAATTCATTAAAGAGGAGAAATTAACTATG-3¢ BS-RibH-DN-G6 EcoRI, NcoI5¢- ATAATAGAAGAATTCATTAAAGAGGAGAAATTAACCATGGGAAATTTAGTTGGTACAG-3¢ BS-RibH-2 ... NcoI5¢- ATAATAGAAGAATTCATTAAAGAGGAGAAATTAACCATGGGAAATTTAGTTGGTACAG-3¢ BS-RibH-2 BamHI 5¢- TATTATGGATTCTTATTCGAAAGAACGGTTTAAG-3¢ Fi...

Ngày tải lên: 23/03/2014, 21:20

8 300 0
Tài liệu Báo cáo khoa học: Biosynthesis of riboflavin Screening for an improved GTP cyclohydrolase II mutant pdf

Tài liệu Báo cáo khoa học: Biosynthesis of riboflavin Screening for an improved GTP cyclohydrolase II mutant pdf

... by the addition of the DNA sequence motif 5¢-GAA TTCattaa agaggagaaattaact ATG AGA GGA TCT CAC CAT CAC CAT CAC CAT GGG ATC GAT CAT-3¢ in front of the start codon. The modified ORF features an Nde1 ... Constructs C and E (Table 1); in fact, preliminary data showed that various mutant protein s selected for their increa sed V max value also showed an increase in their K m value. The...

Ngày tải lên: 18/02/2014, 11:20

11 487 0
Tài liệu Báo cáo khoa học: "ANALYSIS OF OONOUNCTIONS IN PAKSER" potx

Tài liệu Báo cáo khoa học: "ANALYSIS OF OONOUNCTIONS IN PAKSER" potx

... com[xm~t of the FIDO system (a Flexible Interface for Database Operations), which is a prototype allowing an end-user to interact in natural language (Italian) with a relational data base. The ... ANALYSIS OF OONOUNCTIONS IN A ~JLE-~ PAKSER leonardo L~smo and Pietro Torasso Dipartimento di Informatica - Universita' di Torino Via Valperga Caluso 37 - 10125 Torino...

Ngày tải lên: 21/02/2014, 20:20

8 518 0
Báo cáo khoa học: Expression of cholinesterases in human kidney and its variation in renal cell carcinoma types pdf

Báo cáo khoa học: Expression of cholinesterases in human kidney and its variation in renal cell carcinoma types pdf

... Biol Interact 15 7–1 58, 3 7–4 1. 53 Kamal MA, Nasim FH & Al-Jafari AA (1999) Human erythrocyte acetylcholinesterase inhibition by cis- diamminediaquaplatinum (II): a novel kinetic approach. Cancer ... 30, 34 8– 349. 51 Hamamoto Y, Niino K, Ishiyama H & Hosoya T (2004) Impact of pretreatment cholinesterase level on survival of inoperable intrahepatic or hepatic-hilar ca...

Ngày tải lên: 06/03/2014, 22:21

11 475 0
Báo cáo khoa học: "Role of Verbs in Document Analysis" pot

Báo cáo khoa học: "Role of Verbs in Document Analysis" pot

... what, and where. For ex- ample, in summarization, Barzilay and Elhadad (1997) and Lin and Hovy (1997) focus on multi- word noun phrases. For information extraction tasks, such as the DARPA-sponsored ... classes of Levin's EVCA as a basis for our next analysis. 3 Levin's seminal work is based on the time-honored observation that verbs which par- ticipate in simi...

Ngày tải lên: 08/03/2014, 05:21

7 416 0
Báo cáo khoa học: Biosynthesis of riboflavin 6,7-Dimethyl-8-ribityllumazine synthase of Schizosaccharomyces pombe pot

Báo cáo khoa học: Biosynthesis of riboflavin 6,7-Dimethyl-8-ribityllumazine synthase of Schizosaccharomyces pombe pot

... aaaggccctaacccttcagacttaaagggaccagaattgcgcattcttattgtccatgc ccgcggtaatcttcaag 3¢ W27I AseI5¢ aaaggccctaacccttcagacttaaagggaccagaattgcgcattcttattgtccatgcccgc attaatcttcaag 3¢ W27S AsuII 5¢ aaaggccctaacccttcagacttaaagggaccagaattgcgcattcttattgtccatgcccg ttcgaatcttcaag ... mutations are underlined. Designation Endonuclease Sequence A- 1 5¢ ataatagaattcattaaagaggagaaattaactatgttcagtggtattaaaggccc...

Ngày tải lên: 08/03/2014, 10:20

8 343 0
Báo cáo khoa học: Biosynthesis of isoprenoids – studies on the mechanism of 2C-methyl-D-erythritol-4-phosphate synthase pdf

Báo cáo khoa học: Biosynthesis of isoprenoids – studies on the mechanism of 2C-methyl-D-erythritol-4-phosphate synthase pdf

... target for the develop- ment of novel antimalarial agents, which are urgently needed in light of the enormous death toll of malaria [23] and the rapid dissemination of variants with resis- tance ... 4-phosphate in an alternative nonmevalonate pathway for terpenoid biosynthesis. Proc Natl Acad Sci USA 95, 987 9–9 884. 16 Kuzuyama T, Shimizu T, Takahashi S & Seto H...

Ngày tải lên: 16/03/2014, 06:20

14 535 0
Báo cáo khoa học: Deletion of Phe508 in the first nucleotide-binding domain of the cystic fibrosis transmembrane conductance regulator increases its affinity for the heat shock cognate 70 chaperone docx

Báo cáo khoa học: Deletion of Phe508 in the first nucleotide-binding domain of the cystic fibrosis transmembrane conductance regulator increases its affinity for the heat shock cognate 70 chaperone docx

... determined from each set of dose– response data by global fitting of the association and dissociation phases of all binding curves in that dataset (biaeval). The dissociation constant (K D ) for each ... proteins composed of an N-terminal ATPase domain, a substrate-binding region, and a C-terminal 15 kDa ‘lid’ regulating binding affinity for ‘client’ pro- teins. These chaperon...

Ngày tải lên: 23/03/2014, 05:22

13 393 0
w