Báo cáo khoa học: Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal region even without dodecamer formation, which is a prerequisite for DNA protection – novel approaches against Helicobacter pylori inflammation ppt

Báo cáo khoa học: Helicobacter pylori single-stranded DNA binding protein – functional characterization and modulation of H. pylori DnaB helicase activity pptx

Báo cáo khoa học: Helicobacter pylori single-stranded DNA binding protein – functional characterization and modulation of H. pylori DnaB helicase activity pptx

... phos- phorimager (FujiÒlm-BAS-1800; Fuji, Tokyo, Japan) for quantitation. Helicase assay The substrate for helicase assay was prepared by annealing a 29 mer oligo (5¢-CCAAAACCCAGTCACGACGTTGT AAAACG-3¢) to M13mp18 ... initiator protein DnaA and this interaction is essential for DNA replication in Helicob- acter [14,15]. One protein that is central to the DNA replication,...

Ngày tải lên: 30/03/2014, 02:20

13 439 0
Báo cáo khoa học: Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal region even without dodecamer formation, which is a prerequisite for DNA protection – novel approaches against Helicobacter pylori inflammation ppt

Báo cáo khoa học: Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal region even without dodecamer formation, which is a prerequisite for DNA protection – novel approaches against Helicobacter pylori inflammation ppt

... HPNAP_up (5¢-GCGGAA TTC CATATGAAAACATTTGAAATT-3¢) and HPNAP_ low (5¢-GCG GGATCCTTAAGCCAAATGGGCTTG-3¢), HPNAP_up (5¢-GCG GAATTCCATATGAAAACATTTG AAATT-3¢) and HPNAP_low (5¢-CCG CTCGAGAGCC AAATGGG-3¢), ... C-terminal region even without dodecamer formation, which is a prerequisite for DNA protection – novel approaches against Helicobacter pylori inflammati...

Ngày tải lên: 30/03/2014, 04:20

16 352 0
Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf

Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf

... chain A is close to Ala25 of chain B. Chain A Chain B Hydrogen bonds Ala25 Asn77, Arg80 AlaO–ArgNH1 AlaO–ArgND2 Asn26 His35, Arg80, Asn39 AsnOD1–ArgNH1 AsnOD1–HisNE2 Ser28 Arg76 Trp30 Arg42, ... (VIMM), Padua, Italy 3 Department of Chemistry, University of Padua, Italy Introduction Helicobacter pylori is a Gram-negative bacterium that colonizes the human stomach and represents t...

Ngày tải lên: 16/02/2014, 14:20

10 768 0
Báo cáo khoa học: CHIP participates in protein triage decisions by preferentially ubiquitinating Hsp70-bound substrates pdf

Báo cáo khoa học: CHIP participates in protein triage decisions by preferentially ubiquitinating Hsp70-bound substrates pdf

... Tateishi Y, Kawabe Y, Chiba T, Murata S, Ichikawa K, Murayama A, Tanaka K, Baba T, Kato S & Yana- gisawa J (2004) Ligand-dependent switching of ubiqu- itin–proteasome pathways for estrogen ... myosin-directed chaperone UNC-45 by a novel E3 ⁄ E4-multiubiquitylation complex in C. elegans. Cell 118, 33 7–3 49. 55 Imai Y, Soda M, Hatakeyama S, Akagi T, Hashikawa T, Nakayama KI &...

Ngày tải lên: 15/03/2014, 23:20

15 252 0
Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"

Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"

... AATTACCCCCATACTCCTTACACT GGGTCATGGGCTGGGTTTTACTAT 857 COX-I CCTCGGAGCTGGTAAAAA GGGGGTTCGATTCCTTC 1654 COX-II ACTACCCCGATGCATACACCACA GGGCAATGAATGAAGCGAACAG 1333 COX-III GCCGTACGCCTAACCGCTAACA ... Sequence Forward primer (5’→3’) Reverse primer (5’→3’) Anticipated length (bp) D-Loop ATTCTAACCTGAATCGGAGG GATGCTTGCATGTGTAATCT 1528 ATPase8 CCCGGACGTCTAAACCAAACC GGGGATCAATAGAGGGGGAAATA 512 A...

Ngày tải lên: 25/10/2012, 11:18

12 557 2
Tài liệu Báo cáo khoa học: Transient DNA ⁄ RNA-protein interactions docx

Tài liệu Báo cáo khoa học: Transient DNA ⁄ RNA-protein interactions docx

... process, a wealth of information has been obtained about the mechanism by which the ribosome attains its high level of accuracy in translation, its catalytic triad (rRNA, ribosomal protein, and the ... Sanchez R, Pantoja-Uceda D, Prieto J, Diercks T, Marcaida MJ, Montoya G, Campos-Olivas R & Blanco FJ (2010) Solution structure of human growth arrest and DNA damage 45alpha (Ga...

Ngày tải lên: 14/02/2014, 19:20

8 587 0
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

... Quantification of MMP2 was performed using imagequant tl software, version 7.0 (GE Heathcare, Little Chalfont, UK). Statistical analysis Statistical analysis was performed using the graphpad prism, ... Barr and colleagues [35]. GRASP55F in pCDNA3.1 Zeo+ con- tained a C-terminal FLAG tag. Full-length GRASP55, GRASP55 PDZ1 (amino acids 1–1 07), GRASP55 PDZ2 (amino acids 8 4–1 72) and GRA...

Ngày tải lên: 18/02/2014, 04:20

18 603 0
Tài liệu Báo cáo khoa học: Regulators of G-protein signalling are modulated by bacterial lipopeptides and lipopolysaccharide pptx

Tài liệu Báo cáo khoa học: Regulators of G-protein signalling are modulated by bacterial lipopeptides and lipopolysaccharide pptx

... RGS proteins is unclear. Biochemical studies have shown that RGS proteins have GTPase activity and act as a GTPase activating protein (GAP). As a result, RGS proteins enhance GTP hydrolysis rates ... Fukunaga K, Miyazaki K, Okamura H & Miyamoto E (1999) Mitogen-activated protein kinase activation and regulation of cyclooxygenase 2 expression by platelet-activating factor and h...

Ngày tải lên: 18/02/2014, 13:20

11 569 0
Tài liệu Báo cáo khoa học: Combinatorial approaches to protein stability and structure pdf

Tài liệu Báo cáo khoa học: Combinatorial approaches to protein stability and structure pdf

... [7 4–7 6]. Chorismate mutase is thought to catalyze a Claisen condensation principally by binding chorismate in a conformation that favors the pericyclic reaction and allows transition-state stabilization ... the basis of protein structure model the core of a protein as an oil droplet that separates from water, in which achieving intimate van der Waals contacts is relative...

Ngày tải lên: 19/02/2014, 12:20

14 584 0
Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc

Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc

... pathway towards initial cleavage at Arg306 (pathway 1), after which Arg506 can be cleaved, resulting in the formation of a 30 kDa fragment. Kinetic analysis of cleavage of FVa at Arg506 by APC To ... inactivates the coagulation cofactors, FVa and FVIIIa [8], in reactions stimulated by the APC cofactor protein S. FVa consists of a 105 kDa heavy (A1 and A2 domains) and a 7 1–7...

Ngày tải lên: 19/02/2014, 13:20

13 655 0
w