Báo cáo khoa học: Analysis of the CK2-dependent phosphorylation of serine 13 in Cdc37 using a phospho-specific antibody and phospho-affinity gel electrophoresis doc
... Koyasu S, Nishida E, Kadowaki T, Matsuzaki F, Iida K, Harada F, Kasuga M, Sakai H & Yahara I (1986) Two mammalian heat shock proteins, HSP90 and HSP100, are actin-binding proteins. Proc Natl ... [1]. Therefore, the analysis of protein kinase activity and the phosphorylation level of their sub- strates are important for understanding signal trans- duction pathways at a mo...
Ngày tải lên: 30/03/2014, 03:20
... GGTGCT gAGCTCAAGTGTGACTTtcGTCTAC SacI W402F CCGGTG GTcGAcTTTGGTTtcACGCCC SalI E273Q ACGTACTGCTgTCCGGAA AGtACtCCATGGCCGC ScaI D353N TCCAATCCGTtAGTC TGgCCaTAGAACGCGC MscI E356Q GGAGAAT GGTgCCAGGGTACATTTcCAATCCGTCA KpnI D372N ... of 3.2) [45] was a solution in the Dali result. It is likely that the inte rface between N-terminal and b-he lical domains participate in binding of th...
Ngày tải lên: 19/02/2014, 16:20
... Evaluation of Association Measures 2.1 State -of- the- art A standard procedure for the evaluation of AMs is manual judgment of the -best candidates identi- fied in a particular corpus by the measure ... curves. The major drawback of an approach where all low-frequency candidates are excluded is that a large part of the data is lost for collocation extrac- tion. I...
Ngày tải lên: 20/02/2014, 18:20
Báo cáo khóa học: Insight into the activation mechanism of Bordetella pertussis adenylate cyclase by calmodulin using fluorescence spectroscopy pptx
... of the 3D structures of AC and AC–CaM, which are still not available, and labeling of the AC protein at other locations in its regulatory and catalytic domains using single-cysteine mutants are ... site in both the uncomplexed AC and the AC–CaM complex. Dynamics of the AC catalytic domain as probed by acrylodan Taking advantage of the absence of Cys resid...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Bacitracin inhibits the reductive activity of protein disulfide isomerase by disulfide bond formation with free cysteines in the substrate-binding domain pptx
... Cys345 and the thiol form of bacitracin A. The thiol form of the thiazoline ring of bacitracin A and Cys345 are shown as chemical structures, the rest of bacitracin A as ‘Bacitracin A , and all other ... domains, a, b, b¢ and a , and an x-linker region between the b¢-domain and a -domain. The a- domains are catalytically active, the b¢-domain functi...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx
... coding linker containing a NotI site at the 5¢ end of the linker (5¢-GGC CGCAGGTTCGGAGCAGAAGCTGATCAGCGAGGAG GACCTGTAG-3¢) and noncoding linker containing an EcoRI site at the 5¢ end of the linker ... 5¢-CACCC AAGCTTGCCACCATGCAGGTTACTCT GAAAGAGTC-3¢; primer 4, 5¢-CACCC AAGCTTGCCACCATGAAATG CAGCTGGGTTATCTTC-3¢; primer 5, 5¢-CAGAACCACCACCCCCTG AGGAGACGGTGACTGAGGTTCC-3¢; primer 6,...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Principles behind the multifarious control of signal transduction ERK phosphorylation and kinase/phosphatase control potx
... FluorS TM MultiImager (Bio-Rad) and quantified using the multi- analist software (Bio-Rad). All measurements were carried out in the linear range of the method. The standard error of the mean was 4.6% of the ... cellular signaling pathways such as the MAPK cascade. The first kinase was activated by a receptor that switches slowly between an active and an inactive...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx
... the hPAHÆadrenaline/ dopamine binary complex [17] was superimposed onto that of the ligand-free rPAH containing the regulatory and catalytic domains [19] the catecholamine main-chain is also Fig. ... by several mechanisms in order to maintain the phenylalanine and tyrosine homeostasis in vivo despite great fluctuations in the dietary intake of L-Phe and the overal...
Ngày tải lên: 17/03/2014, 09:20
Báo cáo khoa học: Curcumin suppresses the dynamic instability of microtubules, activates the mitotic checkpoint and induces apoptosis in MCF-7 cells ppt
... curcumin increased the accumulation of Mad2 and BubR1 at the kinetochores, indi- cating that it activated the mitotic checkpoint. In addition, curcumin treat- ment increased the metaphase ⁄ anaphase ratio, indicating ... increase in the metaphase ⁄ anaphase ratio. The metaphase ⁄ anaphase ratio was calculated to be 0.43 ± 0.06 and 1.88 ± 0.40 (P < 0.0001) in the a...
Ngày tải lên: 23/03/2014, 03:20
Báo cáo khoa học: Evidence for the slow reaction of hypoxia-inducible factor prolyl hydroxylase 2 with oxygen pptx
... MJ, Padmakumar R & Hausinger RP (1999) Stopped-flow kinetic analysis of Escherichia coli tau- rine ⁄ alpha-ketoglutarate dioxygenase: interactions with alpha-ketoglutarate, taurine, and oxygen. ... Hausinger RP (2005) Steady-state and transient kinetic analyses of taurine ⁄ alpha-ketoglutarate dioxy- genase: effects of oxygen concentration, alternative sul- fonates, and activ...
Ngày tải lên: 23/03/2014, 03:20