Báo cáo khoa học: Ribonuclease H: properties, substrate specificity and roles in retroviral reverse transcription ppt

... -end. Roles of RNase H in reverse transcription Starting with the retroviral plus-strand genome, the process of reverse transcription produces a double- stranded DNA product that is integrated into ... role during reverse transcription in vivo. Given a substrate in which one strand is entirely DNA and the other strand is RNA at the 5¢-end followed by a stretch of DNA...

Ngày tải lên: 30/03/2014, 02:20

... those involved in substrate binding by side chain–side chain interactions, and part of a g iven subsite is indicated by the numbers under the boxes (i.e. 1, S 1 binding site; 2, S 2 binding site, etc.). ... inefficient substrate for TEV protease (peptide 4 in Table 1). Interestingly, even replacing P3 Tyr with Phe (peptide 5 in Table 1) gave rise to a 10-fold increase in K m and...

Ngày tải lên: 19/02/2014, 16:20

... 5¢-AGAAGCCATT GCTGAGCAATTTTTGTTC-3¢ (underlining i ndicates t he Bpu1102I restriction site) and t he reverse primer 5¢-AAA AAGCTTGCACTAATTTTATTT GAC-3¢ (underliningindicates the HindIII restriction site and stop codon, respectively) and ... nucleophile in consensus region II must b e involved in the recognition of a-glucosidic linkages. In conclusion, this work was successful i...

Ngày tải lên: 07/03/2014, 16:20

... noncovalent interactions (dotted lines) involving the residue 39 and E451 were represented. 4-OH is represented in the equatorial (4e; pointing towards left) and axial (4a; pointing upwards) ... alkyl and aryl m oiet- ies) [1]. This broad substrate specificity makes family 1 an interesting model for using to study the molecular basis of the enzymatic specificity. Having a better u...

Ngày tải lên: 16/03/2014, 18:20

... N-domain, and are thus five-domain proteins possessing the catalytic (b/a) 8 -barrel (domain A) and the four domains B, C, D and E. In the case of four-domain proteins without an N-domain, only ... starch-binding domain (Eur. J. Biochem. 270) 645 Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain...

Ngày tải lên: 08/03/2014, 08:20

... 1493 MINIREVIEW Ribonuclease H: molecular diversities, substrate binding domains, and catalytic mechanism of the prokaryotic enzymes Takashi Tadokoro and Shigenori Kanaya Department of Material and ... have a substrate- binding domain at the C- and N-termini, respectively. Both proteins lack a basic protrusion. Further mutational and structural studies will be required to und...

Ngày tải lên: 30/03/2014, 02:20

... BL21(DE3) containing the expression vector, without (lanes 1 and 3) and with the coding sequence for DmTpc1p (lanes 2 and 4). Samples were taken at the time of induction (lanes 1 and 2) and 4 h later ... homo-exchange (i.e. same substrate inside and outside) experiments. Using external and internal substrate concentrations of 1 and 5mm, respectively, the reconstituted prot...

Ngày tải lên: 29/03/2014, 08:20

... analyzed in folding proteins, e.g. in the bovine pancreatic trypsin inhibitor (BPTI) refolding assay. BPTI is a widely studied protein con- taining three disulfides in the native form. In a gluta- thione-based ... PDI-catalyzed insulin aggregation (Fig. 2B; P < 0.05), showing that inhibition of the primary substrate- binding site in the b¢ domain decreases the insulin-reducing ac...

Ngày tải lên: 16/02/2014, 14:20

... specific Ser and Thr residues in target substrates, which inclu de effector protein kin ases, such as MAPK-activated protein kinases and transcription fac- tors, such as activator protein-1 [1–3]. Four ... apoptosis. In the extrinsic pathway, binding of death ligands to their respective receptors recruit adaptor proteins, such as Fas-associated death domain protein, which in turn b...

Ngày tải lên: 16/02/2014, 14:20

... binding profiles in a time-dependent manner in ERE1 and ERE2 (Fig. 5B). In agreement with the above findings, binding of ERa and ERb was increased in both ERE1 and ERE2 in the presence of E2. Interestingly, ... Binding of ERa and ERb was increased in both ERE1 and ERE2 of the HOXC13 promoter (Fig. 5A, lanes 1–4). The levels of E2-induced binding of ERa and ERb were highe...

Ngày tải lên: 18/02/2014, 14:20