Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L ) ppt
Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt
... Identification < /b> of < /b> the < /b> N-termini < /b> of< /b> NADPH < /b> : < /b> protochlorophyllide < /b> oxidoreductase < /b> A < /b> and < /b> B from barley etioplasts (Hordeum vulgare L. ) Matthias Plo¨scher1, Bernhard Granvogl1, Veronika Reisinger1 and < /b> ... Reinbothe S, Reinbothe C, Bereza B &Apel K (199 5) Two routes of < /b> chlorophyllide synthesisthat are differentially regulated by light in barley (Hordeum vulgare L. ). Proc Natl Acad Sci USA 92,3254–3258.9 ... the< /b> N-terminal amino acid of < /b> PORA (Fig. 4). The < /b> twoadditional N-terminal peptides of < /b> PORB both startwith the < /b> amino acid alanine. In parallel with the < /b> loss of < /b> one and < /b> two amino groups, the < /b> signals of < /b> the...
- 8
- 362
- 0
Báo cáo khoa học: Identification in the yeast Pichia stipitis of the first L-rhamnose-1-dehydrogenase gene docx
... expression of < /b> RHA1 in P. stipitis on L- rhamnose (lane A)< /b> , D-glucose (lane B) ,maltose (lane C),D-galactose (lane D), D-xylose (lane E) and < /b> a < /b> glyc-erol ⁄ ethanol mixture (lane F). The < /b> lower panel shows ... microorganisms liv-ing on decaying plant material are able to use l- rham-nose as a < /b> source of < /b> carbon and < /b> energy. There are atleast two pathways for the < /b> catabolism of < /b> l- rhamnose,one with phosphorylated ... showed the < /b> highest activity and< /b> affinity with l- rhamnose and < /b> a < /b> lower activity and < /b> affinity with l- mannose and < /b> l- lyxose. The < /b> enzyme was specific for NAD. A < /b> northern blot analysisrevealed that transcription...
- 7
- 274
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... I:CPHAPHA LPSLPS Poly I:CPoly I:CPHAPHALPSLPSPoly I:CPoly I:CPHAPHALPSLPSPoly I:CPoly I:CPHAPHALPSLPSPoly I:CPoly I:CPHAPHALPSLPSPoly I:CPoly I:CPHAPHALPSLPSPoly I:CPoly ... GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT Initial ... known as IL-17E), which areimportant in the < /b> generation of < /b> the < /b> correct class of< /b> antibodies by B- cells, and < /b> for the < /b> elimination of< /b> extracellular pathogens, such as helminths and < /b> otherextracellular...
- 20
- 689
- 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx
... MD.Supplementary material The < /b> following supplementary material is availableonline:Table S1. Best blastx hits obtained for the < /b> identifica-tion of < /b> RpCAbr transcript.This material is available as part ... cuticle; bf,branchial filament; bl, branchial lamellae. (B) Transverse section showing the < /b> morphological structure of < /b> a < /b> branchial filament with cuticle (c),tufts of < /b> cilia (cil), epithelial cells ... organism transcrip-tome. A < /b> total of < /b> four libraries were obtained: branchialplume versus body wall subtracted library (and < /b> its recipro-cal) and < /b> trophosome versus body wall subtracted library(and...
- 14
- 591
- 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx
... AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAAHYPK GGAAATGGAAATAACAAGACAAATAGCGCGCAACTAATGCTTCCACAAHSP70 TGACCAAGGCAACAGAACCAAATCAGACGGCCGGTATGTGHeat shock 70 kDa protein 1 2A < /b> CGAAAAAGGACAGCAGTTGAAACTCATCCTCCACCGGATTGTHSP23 ... in B cells, kinasecomplex-associated proteinAAAGCAGAGCAGAAAAAGTGGAAGGACAATGCCGCGATCAGNon-selenium glutathione peroxidase CAATGAACAAAAAAGTCGCAACAGGGATGGAGGGTAAGACCATACAGlutamine synthetase ... CGTCCGATTTCTTCTCGTGTTTACCAGAAGACATTACAGTGAAAATTGAChaperonin-containing TCP1, subunit 7, isoform b, isoform 1 GGGAACCAGCAGTCGTCAAACGTCCACTGAGAGGATGAGACAInhibitor of < /b> kappa light polypeptide enhancer...
- 11
- 570
- 0
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt
... of < /b> polyclonal anti-eEF 1A < /b> (lane 4), withnuclearproteinsand0.9lg of < /b> polyclonal anti-eEF 1A < /b> (lane 5), withnuclearproteinsand9lg of < /b> total CRS (lane 6), with nuclear proteins and < /b> 0.9 lg of < /b> total CRS ... ng (lane 3), 50 ng (lane 4), 100 ng (lane 5) or 200 ng(lane 6) of < /b> nonlabelled CT oligomer. An identical aliquot was incu-batedwith2ngofc32P-labelled CT probe (CT) in the < /b> absence (lane 7) or ... T-lymphoblastic cancer cell line specifically bindingto aptameric cytotoxic GT oligomersBarbara Dapas1, Gianluca Tell2, Andrea Scaloni3, Alex Pines2, Lino Ferrara3, Franco Quadrifoglio1and...
- 12
- 552
- 0
Báo cáo khoa học: Identification of the amniotic fluid insulin-like growth factor binding protein-1 phosphorylation sites and propensity to proteolysis of the isoforms docx
... has also been shown to playcrucial roles in ovarian, endometrial, trophoblast and< /b> fetal–placental physiology and < /b> pathology and < /b> its levelin maternal as well as in fetal circulation and < /b> in the < /b> ... displaying proteolyticactivity: 2 lL (lane 2); 4 lL (lane 3); 8 lL (lane 4); and < /b> 16 lL (lane 5). Sample volumes were adjusted to 30 lL and < /b> incubations wereterminated after 48 h by the < /b> addition ... protein. Because the < /b> process can be the < /b> con-sequence of < /b> a < /b> combination of < /b> biological variables,including different activity levels of < /b> both the < /b> intracellu-lar protein kinases and < /b> the < /b> extracellular...
- 14
- 469
- 0
Báo cáo khoa học: Identification of the structural determinant responsible for the phosphorylation of G-protein activated potassium channel 1 by cAMP-dependent protein kinase pdf
... mL L )1 methanol, 100 mL L )1 acetic acid;Destain I: 500 mL L )1 methanol, 100 mL L )1 acetic acid;Destain II: 50 mL L )1 methanol, 70 mL L )1 acetic acid.ND9 6: < /b> 96 mmol L )1 NaCl, 2 mmol L )1 KCl, ... phosphorylation of < /b> recombinant, truncated, GIRK1 by the < /b> catalytic subunit of < /b> PKA. In the < /b> lower panels, the < /b> mean values and< /b> standard error of < /b> mean values of < /b> relative specific radioactivity of < /b> the < /b> different ... Ltd,Jerusalem, Israel); Protein A < /b> Sepharose (CL- 4B beads;Pharmacia LKB Biotechnology AB, Uppsala, Sweden);SpCAMPS, RpCAMPS (A1< /b> 66, A1< /b> 65, respectively; Sigma-Aldrich, St Louis, MO, USA); [32P]ATP[cP]...
- 9
- 403
- 0
Báo cáo khoa học: Identification of multiple isoforms of the cAMP-dependent protein kinase catalytic subunit in the bivalve mollusc Mytilus galloprovincialis potx
... MJ, Ibarguren I, Hellman U & Villamarı´nJA (200 3) Characterization of < /b> a < /b> type I regulatory sub-unit of < /b> cAMP-dependent protein kinase from the< /b> bivalve mollusk Mytilus galloprovincialis. Arch ... catalytic subunitisoforms from the < /b> lone star tick, Amblyommaamericanum (L) . Insect Biochem Mol Biol 29, 43–51.28 Beushausen S, Lee E, Walker B & Bayley H (199 2) Catalytic subunits of < /b> Aplysia neuronal ... 2008 FEBS 4489 Identification < /b> of < /b> multiple isoforms of < /b> the < /b> cAMP-dependentprotein kinase catalytic subunit in the < /b> bivalve molluscMytilus galloprovincialisJose´R. Bardales1, Ulf Hellman2and...
- 11
- 509
- 0
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot
... sequences of < /b> DBD and< /b> LBD (after helix 2). This material is available as part of < /b> the < /b> online article from http://www.blackwell-synergy.comPlease note: Blackwell Publishing is not responsiblefor the < /b> ... Crystal structure of< /b> the < /b> RAR-gamma ligand-binding domain bound toall-trans retinoic acid. Nature 378, 681–689.Supplementary material The < /b> following supplementary material is availableonline:S. ... deducedDBD and < /b> LBD sequences (after helix 2) alignedwith clustalw (http://www.cf.ac.uk/biosi/research/biosoft/Downloads/clustalw.html) (supplementary Fig. S 3). Phylo-genetic analysis of < /b> the < /b> data...
- 16
- 542
- 0
Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP