Báo cáo khoa học: How does a knotted protein fold? doc

... structural, molecular and computational biologists. The past two decades have seen the folding pathways of many proteins characterized in detail using experimental and computational approaches. Current ... 375 REVIEW ARTICLE How does a knotted protein fold? Anna L. Mallam St John’s College and University Chemical Laboratory, Cambridge, UK The protein- folding problem continues to...

Ngày tải lên: 30/03/2014, 02:20

... Kanto T, Hayashi N, Takehara T, Hagiwara H, Mita E, Naito M, Kasahara A, Fusamoto H & Kamada T (1994) Buoyant density of hepatitis C virus recovered from infected hosts: two different features ... is catalyzed by the NS3 protease and its cofactor NS 4A. In addition to the N-terminal protease domain, the carboxy-terminal domain of NS3 consists of an RNA helicase and NTPase activity. NS 4A...

Ngày tải lên: 19/02/2014, 06:20

... quantified. 9) A dog is eating meat. 10) A dog eats meat. 1 0a) Dogs eat meat. Ii) A man who loves a woman is happy. 12) A man who loves a woman respects her. 13) A man who loves a woman ... quantification for a sentence. This is a rather unattractive state of affairs: Traditionally, it was assumed that at least the form of quantifiers in hrL sentences was unprob...

Ngày tải lên: 24/03/2014, 05:21

... sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans. Antonie Leeuwenhoek 66, 111–127. 13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997) Gene ... similarity. A crystal structure of Met8P has shown that this protein has an aspartate residue (Asp141), which is important for both chelatase and dehydrogenase function [17]; inter...

Ngày tải lên: 15/02/2014, 01:20

... 5¢-GAGCCCGGATCCACCATGAA GGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAAT TCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRI restriction sites. The PCR-amplified ... BrC15-Ac was shown to efficiently quench W81, as observed with M. brassicae CSPMbraA6 [32]. We observed also that BrC15-Ac was able to displace ASA, suggesting that brominated fatty acid an...

Ngày tải lên: 21/02/2014, 03:20

... COHERENCE: A PLAN-BASED ALTERNATIVE Diane J. Litman AT&T Bell Laboratories 3C-40 8A 600 Mountain Avenue Murray Hill, NJ 079741 ABSTRACT To fully understand a sequence of utterances, one ... fragment, taken from a terminal transcript between a user and a computer operator (Mann [12]): Could you mount a magtape for me? It's tape 1. Such a fragment appears coh...

Ngày tải lên: 21/02/2014, 20:20

... words take and on are familiar to the learner, who also remembers the biblical story of David and Goliath. The program, modeling a language learner, interacts with a native speaker, as follows: ... 5: A Variety of Phrases for TAKE where variables ?x, :y and ?z also appear in correspond- in& concepts (not shown here). How are these patterns 287 actually applied in conceptua...

Ngày tải lên: 08/03/2014, 18:20

... genome databanks. Interestingly, this domain was found in some closely related bacterial species, but mainly in nonvertebrate animals, and invariably connected via a linker to an animal-type a- amylase ... the noticeable exception of the a- amylase from the bacte- rium Pseudoalteromonas haloplanktis, which displays an additional small (21 kDa) C-terminal domain hav- ing the size of a ca...

Ngày tải lên: 14/02/2014, 18:20

... N-terminus was obtained by PCR from the plasmid pET21 ⁄ SIC1 [32] with a forward primer (5¢-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3¢) designed to introduce a hexahistidine tag and a ... N-terminal hexahistidine tag was obtained by PCR using the pET2 1a ⁄ PNT- H6 plasmid [30] as the template. The forward primer (5¢-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3¢) was desi...

Ngày tải lên: 18/02/2014, 04:20

Ngày tải lên: 21/02/2014, 20:20