Báo cáo khoa học: How does a knotted protein fold? doc
Báo cáo khoa học: How does a knotted protein fold? doc
... structural, molecular and computationalbiologists. The past two decades have seen the foldingpathways of many proteins characterized in detailusing experimental and computational approaches.Current ... 375REVIEW ARTICLE How does a knotted protein fold? Anna L. MallamSt John’s College and University Chemical Laboratory, Cambridge, UKThe protein- folding problem continues to be a majorchallenge ... funnel at a particular energy repre-sents the chain entropy, resulting in a broad top thatindicates the large number of conformations availableto the denatured state. Natural proteins have evolvedto...
- 11
- 243
- 0
Tài liệu Báo cáo khoa học: How does hepatitis C virus enter cells? pptx
... Kanto T, Hayashi N, Takehara T, Hagiwara H, MitaE, Naito M, Kasahara A, Fusamoto H & Kamada T(1994) Buoyant density of hepatitis C virus recoveredfrom infected hosts: two different features ... is catalyzed by the NS3 proteaseand its cofactor NS 4A. In addition to the N-terminalprotease domain, the carboxy-terminal domain of NS3consists of an RNA helicase and NTPase activity.NS 4A serves ... Dubois F, Barin F,Goudeau A & Roingeard P (1998) Ultrastructural andphysicochemical characterization of the hepatitis C virusrecovered from the serum of an agammaglobulinemicpatient. Arch Virol...
- 15
- 570
- 0
Báo cáo khoa học: "HOW DOES NATURAL LANGUAGE QUANTIFY" pdf
... quantified. 9) A dog is eating meat. 10) A dog eats meat. 1 0a) Dogs eat meat. Ii) A man who loves a woman is happy. 12) A man who loves a woman respects her. 13) A man who loves a woman ... quantification for a sentence. This is a rather unattractive state of affairs: Traditionally, it was assumed that at least the form of quantifiers in hrL sentences was unproble- matical, and ... look at examples 9 to 1 0a. They are striking cases in that 9 is a prototypical case of an assertion about an indivi- dual event and 10 and 1 0a are equally prototypi- cal universal ~ules. However,...
- 8
- 239
- 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... sequencingand mutational analysis of a gene cluster involved innitrite reduction in Paracoccus denitrificans. AntonieLeeuwenhoek 66, 111–127.13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997)Gene ... similarity. A crystalstructure of Met8P has shown that this protein hasan aspartate residue (Asp141), which is importantfor both chelatase and dehydrogenase function [17];interestingly, this aspartate, ... total cell lysate and theperiplasmic fraction, but was absent from the membrane and cytoplasmic fractions. (B) The same cell fractions as shown in (A) when sub-jected to SDS ⁄ PAGE analysis and...
- 12
- 613
- 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf
... 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRIrestriction sites. The PCR-amplified ... BrC15-Ac was shown to efficientlyquench W81, as observed with M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated ... thatof the N-terminal sequence of the natural ASP3c protein [20] showed that a 21-residue N-terminal signal sequence iscleaved after translation. The average molar mass calculatedfor the mature...
- 11
- 642
- 0
Tài liệu Báo cáo khoa học: "LINGUISTIC COHERENCE: A PLAN-BASED ALTERNATIVE" doc
... COHERENCE: A PLAN-BASED ALTERNATIVE Diane J. Litman AT&T Bell Laboratories 3C-40 8A 600 Mountain Avenue Murray Hill, NJ 079741 ABSTRACT To fully understand a sequence of utterances, one ... fragment, taken from a terminal transcript between a user and a computer operator (Mann [12]): Could you mount a magtape for me? It's tape 1. Such a fragment appears coherent because ... abstraction as a single action achieving a goal, such an action might not be executable, i.e. it might be an abstract as opposed to primitive action. Abstract actions are in actuality composed...
- 9
- 235
- 0
Báo cáo khoa học: "To wards a Self-Extending Lexicon *" doc
... words take and on are familiar to the learner, who also remembers the biblical story of David and Goliath. The program, modeling a language learner, interacts with a native speaker, as follows: ... 5: A Variety of Phrases for TAKE where variables ?x, :y and ?z also appear in correspond- in& concepts (not shown here). How are these patterns 287 actually applied in conceptual analysis? ... PHRAN [AJ'ens82 l, the conceptual analyzer, and PHRED [Jacobs85] the generator, share a phrasal lepton. As outlined by Wilensky {Wilensky81] this lexicon provides a declarative database,...
- 9
- 302
- 0
Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt
... genomedatabanks. Interestingly, this domain was found insome closely related bacterial species, but mainly innonvertebrate animals, and invariably connected via a linker to an animal-type a- amylase ... thenoticeable exception of the a- amylase from the bacte-rium Pseudoalteromonas haloplanktis, which displaysan additional small (21 kDa) C-terminal domain hav-ing the size of a carbohydrate-binding ... Sequence data were depos-ited in GenBank (Table S1).Searches in databasesUsing the putative C-terminal domain of C. fluminea as a query, sequence databases were searched by blastp andtblastn for...
- 8
- 624
- 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx
... N-terminus was obtained by PCR from theplasmid pET21 ⁄ SIC1 [32] with a forward primer (5¢-TACCTGGCCAATGAATATGCATCATCATCATCATCATACTCCGTCGACCCCACC-3¢) designed to introduce a hexahistidine tag and a ... N-terminalhexahistidine tag was obtained by PCR using thepET2 1a ⁄ PNT-H6plasmid [30] as the template. The forwardprimer (5¢-TACCGTTAACATCGATATGCATCATCATCATCATCATGC-3¢) was designed to insert a ClaI ... tothank Antonino Natalello and Silvia Maria Doglia fortheir assistance with the fluorescence spectroscopy, aswell as for critically reading the manuscript. We areindebted to Maria Samalikova...
- 14
- 672
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ