Báo cáo khoa học: Characterization of a membrane-bound angiotensin-converting enzyme isoform in crayfish testis and evidence for its release into the seminal fluid ppt

... works Characterization of a membrane-bound angiotensin-converting enzyme isoform in crayfish testis and evidence for its release into the seminal fluid Juraj Simunic, Daniel Soyez and Ne ´ dia Kamech Equipe ... 2009) doi:10.1111/j.1742-4658.2009.07169.x In the present study, an isoform of angiotensin-converting enzyme was characterized from...

Ngày tải lên: 30/03/2014, 01:20

... CLAP_1:AA GATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 1870 Fig. ... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACG...

Ngày tải lên: 07/03/2014, 16:20

... kept at 4 °C and used within 10 days. Quantification of alkaline phosphatase and aminopeptidase activities Specific alkaline phosphatase (ALP) and N-aminopeptidase (APN) enzymatic activities of BBMV ... 0.2 M GalNAc GalNAca1 fi 3Gal Sophora japonica (SJA) Galb1 fi 3GalNAc 0.2 M Gal Galb1 fi 3,4GlcNAc Wistaria floribunda (WFL) a/ bGalNAc 0.2 M GalNAc Helix pomatia (HPL) GalNAca1 fi 3GalNAc...

Ngày tải lên: 23/03/2014, 13:20

... mm EDTA at 37 °C and 50 °C and samples were collected after 15, 30, 60, 90 and 120 min. At each time point, the sample was incubated on ice for 5 min and remaining activity toward Suc-AAPF-pNA was ... Tanaka K, Kawai M, Tainaka K, Imada C, Okami Y & Inamori Y (1993) Cloning and sequence of an alkaline serine protease-encoding gene from the marine bacterium Alteromonas sp...

Ngày tải lên: 19/02/2014, 07:20

... that brominated fatty acid and ASA both associated with W81 in the same ligand binding site. The ligand binding activity of ASP3c was further investigated using displacement of ASA, a fatty acid ... CSP. EXPERIMENTAL PROCEDURES Strains and materials Escherichia coli strain DH 5a was used for DNA subcloning and propagation of the recombinant plasmid. Pichia pastoris st...

Ngày tải lên: 21/02/2014, 03:20

... transcription of Aro80 target genes [14]. Therefore, potentially, ARO10 and its associated genes may be responsible for the catabo- lism of aromatic and branched-chain amino acids, as well as ... sequence, confirming that the N-terminal Met and Ala were indeed absent. Although cleavage of the terminal Met was not unexpected, the loss of the alanine residue was initi...

Ngày tải lên: 06/03/2014, 00:21

... Norway Haemerythrin proteins comprise a family of O 2 -carrry- ing proteins mainly found in a few phyla of marine invertebrates. Members of this family differ from haemoglobin and haemocyanin in that they ... as a template. The quality of the model was first assessed using procheck [32,33]. The vast majority of residues (89.7%) fall into the most favoured region...

Ngày tải lên: 07/03/2014, 17:20

... binding of PA1b to a proteinaceous component of a particulate fraction of S. oryzae extracts. The binding was saturable and reversible, and the binding site exhibits a high affinity for the native 3741 ... tubes. The radioactivity was counted on a gamma counter (Riastar, Packard Instrument, USA), and each point was the mean of triplicates. Binding data were an...

Ngày tải lên: 08/03/2014, 02:21

... by fitting data by a weighted linear regression using the software SigmaPlotÒ. AlabNA, L-alanine-b-naphthylamide; AlapNA, L-alanine-p-nitroanilide; ArgpNA, L-arginine-p-nitroanilide; MetbNA, L-methionine-b-naphthylamide; ... Bmo AAX39866 Tni APN4 AAK69605 Sli AAF37559 Hpu APN2 AAK58066 Hvi AAC36148 Pin AAX39865 Tni APN3 AAF01259 Pxy APN3 Q11000 Hvi AAN75694 Har APN2 AAF37560 Hpu APN3 AAF99...

Ngày tải lên: 16/03/2014, 12:20

... prevent the abnormal accumulation of intracellular acyl-CoA. We have isolated a thioesterase from Alcaligenes faecalis ISH108 and demonstrated its application in chemoselective and racemization ... pH 7.2, containing 0.1 m NaCl. The reaction was started by the addition of 0.2 lg enzyme. The initial rate was determined by measuring the increase in A 346 , the iso...

Ngày tải lên: 16/03/2014, 13:20