Báo cáo khoa học: Engineering of monomeric FK506-binding protein 22 with peptidyl prolyl cis-trans isomerase Importance of a V-shaped dimeric structure for binding to protein substrate docx

Báo cáo khoa học: Engineering of a monomeric and low-glycosylated form of human butyrylcholinesterase pdf

Báo cáo khoa học: Engineering of a monomeric and low-glycosylated form of human butyrylcholinesterase pdf

... crystallized forms of Torpedo californica, human and mouse AChEs. According to this alignment, the X- ray structure of Torpedo californica AChE should provid e a good probe model to solve the structure ... by anion-exchange and af®nity chromatography. Axelsen et al. reported that decamethonium, used during the last af®nity chromatogra- phy step of T. californica AChE, was pres...

Ngày tải lên: 17/03/2014, 11:20

8 473 0
Báo cáo khoa học: Engineering of monomeric FK506-binding protein 22 with peptidyl prolyl cis-trans isomerase Importance of a V-shaped dimeric structure for binding to protein substrate docx

Báo cáo khoa học: Engineering of monomeric FK506-binding protein 22 with peptidyl prolyl cis-trans isomerase Importance of a V-shaped dimeric structure for binding to protein substrate docx

... 5¢-AGAGAGAATT CATATGTCAGATT TGTTCAG-3¢ for primer 1; 5¢-TTCCATACCACCACCT GCAACTTGAAGCTC-3¢ for primer 2; 5¢-GTTGCAGGT GGTGGTATGGAACAGCATGCT-3¢ for primer 3; and 5¢-GGCCACT GGATCCAACTACAGCAATTCTCA-3¢ for primer ... Angkawidjaja 1 , Yuichi Koga 1 , Kazufumi Takano 1,2 and Shigenori Kanaya 1 1 Department of Material and Life Science, Graduate School of Engineering, Osaka University,...

Ngày tải lên: 30/03/2014, 01:20

11 355 0
Báo cáo khoa học: Engineering and characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition potx

Báo cáo khoa học: Engineering and characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition potx

... was used to transform QC774 cells, and this transformant was plated onto a 1 lm paraquat plate so as to obtain approximately 4000 transformants. The growth (or lack of growth) of these Q14 3A ... were plated again on 1 lm paraquat agar plates, so as to obtain approximately 500 colonies per plate. After incubation of these replated mutant colonies at 37 °C for another 20–24 h,...

Ngày tải lên: 07/03/2014, 11:20

9 416 0
Báo cáo khoa học: Engineering thermal stability of L-asparaginase by in vitro directed evolution ppt

Báo cáo khoa học: Engineering thermal stability of L-asparaginase by in vitro directed evolution ppt

... reaction were the 5¢-ATGGAACGATGGTTTAAATCTCTG-3¢ and 5¢-ATG TTTAACGCATTATTCGTTGTTGTTTTTG-3¢, and the reverse primers were the 5¢ -TCAATAGGTGTGGAAATA GTCCTGG-3¢ and 5¢-TTAAGCTTTTAATAAGCGTGG AAGTAATCC-3¢. ... inactivation of the mutant Asp133Val and its saturation variants. The residual activities of the mutant Asp133Val (e) and of the saturation variants were measured at var- ious times...

Ngày tải lên: 30/03/2014, 02:20

12 389 0
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

... albeit with F,W angles far from the allowed Ramachandran region, are virtually identical to that of FVIIa. Model- ling of Ala372 (223 ) into FVIIa showed that the Cb atom clashed with that of Arg315(170C), ... processed at a reduced rate by G37 2A- FVIIa, and K m for S -228 8 was increased by a factor of four (Fig. 1A) . Results obtained with S-2366 also revealed a red...

Ngày tải lên: 18/02/2014, 08:20

11 619 0
Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx

Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx

... mori: characterization and immunohistochemistry. Mol Cell Endocrinol 51, 227 – 235. 41 Nagata K, Maruyama K, Nagasawa H, Urushibata I, Isogai A, Ishizaki H & Suzuki A (1992) Bombyxin-II and its ... HF & Grunert LW (2002) Bombyxin is a growth factor for wing imaginal disks in Lepidoptera. Proc Natl Acad Sci USA 99, 15446–15450. 30 Satake S, Masumura M, Ishizaki H, Nagata K, Kat...

Ngày tải lên: 18/02/2014, 13:20

12 707 0
Tài liệu Báo cáo khoa học: Amino acid discrimination by arginyl-tRNA synthetases as revealed by an examination of natural specificity variants doc

Tài liệu Báo cáo khoa học: Amino acid discrimination by arginyl-tRNA synthetases as revealed by an examination of natural specificity variants doc

... further decrease the stability of the canavany- lated species. The role of tRNA as a cofactor for aminoacylation in those aminoacyl-tRNA synthetases that require tRNA for amino acid activation is ... substrate of 1.3 mm was determined, and the relative magnitude of the k cat ⁄ K M parameters for arginine and canavanine charging revealed a discrimination factor of 485; a...

Ngày tải lên: 18/02/2014, 13:20

12 560 0
Tài liệu Báo cáo khoa học: Interleukin-1-inducible MCPIP protein has structural and functional properties of RNase and participates in degradation of IL-1b mRNA doc

Tài liệu Báo cáo khoa học: Interleukin-1-inducible MCPIP protein has structural and functional properties of RNase and participates in degradation of IL-1b mRNA doc

... genes: elongation factor 2 (EF-2), 5¢-GACATCACCAAGGGTGTGCA-3¢ (forward) and 5¢-TTCAGCACACTGGCATAGAGGC-3¢ (reverse); GAPDH,5¢-CCGAGCCACATCGCTCAGAC-3¢ (forward) and 5¢-GTTGAGGTCAATGAAGGGGTC-3¢ (reverse). ... and functional properties of RNase and participates in degradation of IL-1b mRNA Danuta Mizgalska 1 , Paulina We˛ grzyn 1 , Krzysztof Murzyn 2 , Aneta Kasza 1 , Aleksander Koj 1 , Jacek...

Ngày tải lên: 18/02/2014, 14:20

14 598 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx

Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx

... GGAAGTCTCCCTTCCCAGAC CGATTTGCTGACCACCTTCT MLL1 GAGGACCCCGGATTAAACAT GGAGCAAGAGGTTCAGCATC MLL2 GTGCAGCAGAAGATGGTGAA GCACAATGCTGTCAGGAGAA MLL3 AAGCAAACGGACTCAGAGGA ACAAGCCATAGGAGGTGGTG MLL4 GTCTATGCGCAGTGGAGACA ... TGCCCTCATATAAACCTGGAA AGCCTTTGGGAGTAGGAACC ERa antisense CATGGTCATGGTCAG a ERb antisense GAATGTCATAGCTGA a MLL1 antisense TGCCAGTCGTTCCTCTCCAC a MLL2 antisense ACTCTGCCACTTCCCG...

Ngày tải lên: 18/02/2014, 14:20

12 519 0
Tài liệu Báo cáo khoa học: Altered deoxyribonucleotide pools in T-lymphoblastoid cells expressing the multisubstrate nucleoside kinase of Drosophila melanogaster doc

Tài liệu Báo cáo khoa học: Altered deoxyribonucleotide pools in T-lymphoblastoid cells expressing the multisubstrate nucleoside kinase of Drosophila melanogaster doc

... to the mean nuclear DNA (nDNA) value for a given extract (mtDNA ⁄ nDNA). Furthermore, these values were expressed as a percentage related to the value resulting from the designated calibrator sample ... second-derivative maximum of each amplification reaction and relating it to its respective stand- ard curve. The results from the quantitative PCR were expressed as the ratio of...

Ngày tải lên: 20/02/2014, 01:20

11 506 0
w