Báo cáo khoa học: MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells doc

Báo cáo khoa học: MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells doc

Báo cáo khoa học: MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells doc

... compilation ª 2009 FEBS MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells Alessandro Salvi 1 , Cristiano Sabelli 1 , Silvia ... 2981 44 Tavian D, Salvi A, De Petro G & Barlati S (2003) Sta- ble expression of antisense urokinase mRNA inhibits the proliferation and invasion of hu...

Ngày tải lên: 29/03/2014, 23:20

17 288 0
Báo cáo khoa học: Substrate recognition by three family 13 yeast a-glucosidases Evaluation of deoxygenated and conformationally biased isomaltosides pptx

Báo cáo khoa học: Substrate recognition by three family 13 yeast a-glucosidases Evaluation of deoxygenated and conformationally biased isomaltosides pptx

... parameters and DDGà for hydrolysis of isomaltose and p-nitrophenyl -a- D -glucopyranoside, and mono-deoxy analogs of methyl a- isomaltoside at binding subsite +1 by a- glucosidases and glucoamylase. Substrate ... Substrate analogs such as deoxygenated sugars, facilitate identi®cation of critical contacts and enable quanti®cation of the energetics of the protein±carbohyd...

Ngày tải lên: 23/03/2014, 21:21

7 374 0
Báo cáo khoa học: Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 pot

Báo cáo khoa học: Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 pot

... 1:1. Transduction of human MPS IVA fibroblasts and murine MPS IVA chondrocytes Human MPS IVA fibroblasts Transduction of human MPS IVA fibroblasts with the CMV–GALNS, AAT–GALNS or EF1–GALNS gave 36.5%, 54.6% and ... SUMF1 cDNA. Production and purification of AAV vectors AAV vectors were produced by calcium phosphate-medi- ated cotransfection of pAAV–CMV–GALNS, pAAV– AAT–GALNS...

Ngày tải lên: 29/03/2014, 21:20

12 461 0
Báo cáo khoa học: NrpRII mediates contacts between NrpRI and general transcription factors in the archaeon ¨ Methanosarcina mazei Go1 pot

Báo cáo khoa học: NrpRII mediates contacts between NrpRI and general transcription factors in the archaeon ¨ Methanosarcina mazei Go1 pot

... His.for 5¢-GGGTGGA CATATGAGCGAATC ⁄ Mm1027 His.rev 5¢-GTTTG AAGCTTTTATAAAAGACCCATAC; Mm1028 His.for 5¢-GGTTGA CATATGAGCGAATC ⁄ Mm1028 His. rev 5¢-G AAGCTTCTTATAAAAGCCCC; and Mm 1772 His.for 5 ¢-GGTGATAT CATATGGTAGAAGTCG ... 2184 His.rev 5¢-GA GAATTCATTT- AATAAAGAAGTCCTAAG) that added flanking BamHI and EcoRI sites and facilitated cloning the 580-bp fragment into the BamHI and EcoRI sit...

Ngày tải lên: 29/03/2014, 21:20

14 391 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

... potential errors (bias and random error) related to data based on clinical examina- Acta Veterinaria Scandinavica 2009, 51:36 http://www.actavetscand.com/content/51/1/36 Page 7 of 10 (page number ... consequences of variation and bias in relation to monitoring of animal disease incidence on herd and national level, causal analysis on national level, as well as estimation of vali...

Ngày tải lên: 25/10/2012, 10:45

10 588 0
Tài liệu Báo cáo khoa học: Secondary substrate binding strongly affects activity and binding affinity of Bacillus subtilis and Aspergillus niger GH11 xylanases docx

Tài liệu Báo cáo khoa học: Secondary substrate binding strongly affects activity and binding affinity of Bacillus subtilis and Aspergillus niger GH11 xylanases docx

... Venkataraman V, Sait HBR, Kasinathan C & Ramasubbu N (2008) Probing the role of aromatic residues at the secondary saccha- ride-binding sites of human salivary alpha-amylase in substrate ... arabinoxylan (WU-AX) (A) and oat spelt xylan (OSX) (B) and of A. niger xylanase mutants to water-unextractable arabinoxylan (C) and oat spelt xylan (D). S. Cuyvers et al. Secondary subs...

Ngày tải lên: 14/02/2014, 19:20

14 601 0
Tài liệu Báo cáo khoa học: Amprenavir complexes with HIV-1 protease and its drug-resistant mutants altering hydrophobic clusters docx

Tài liệu Báo cáo khoa học: Amprenavir complexes with HIV-1 protease and its drug-resistant mutants altering hydrophobic clusters docx

... Atlanta, GA, USA 2 Department of Computer Science, Molecular Basis of Disease Program, Georgia State Univers’ity, Atlanta, GA, USA 3 Department of Chemistry, Molecular Basis of Disease Program, ... side chains of Asp30 and Asp30¢ accommodate diverse functional groups at P2 and P2¢ of SQV and APV at the surface of the PR active site cavity. The functional group can be criti...

Ngày tải lên: 18/02/2014, 04:20

16 583 0
Tài liệu Báo cáo khoa học: Pyruvate reduces DNA damage during hypoxia and after reoxygenation in hepatocellular carcinoma cells pptx

Tài liệu Báo cáo khoa học: Pyruvate reduces DNA damage during hypoxia and after reoxygenation in hepatocellular carcinoma cells pptx

... and on studying DNA damage. The metabolism of glutathione and DNA breaks were investigated in hepatocellular carcinoma HepG2 cells cultivated with or without pyruvate during and after hypoxia. In ... for quantitative deter- mination of nanogram amounts of total and oxidized glutathione: applications to mammalian blood and other tissues. Anal Biochem 27, 502–522. Pyruvate...

Ngày tải lên: 18/02/2014, 16:20

11 479 0
Tài liệu Báo cáo khoa học: Cytokinin oxidase/dehydrogenase genes in barley and wheat docx

Tài liệu Báo cáo khoa học: Cytokinin oxidase/dehydrogenase genes in barley and wheat docx

... functionality for one of them in transgenic tobacco an d Arabidopsis plants. Materials and methods Plant materials Commercial barley (H. vulgare cv. Luxor) and wheat (T. aestivum L. cv. Samantha) grains ... was assayed according to Bradford [28], with BSA as the standard. Extraction and analysis of cytokinins Two grams of frozen plant material (barley kernels, 7- and 14-day-old...

Ngày tải lên: 19/02/2014, 16:20

13 531 0
Tài liệu Báo cáo khoa học: 1,5-Diamino-2-pentyne is both a substrate and inactivator of plant copper amine oxidases ppt

Tài liệu Báo cáo khoa học: 1,5-Diamino-2-pentyne is both a substrate and inactivator of plant copper amine oxidases ppt

... 1,5-diamino-2-pentyne (DAPY). The unsymmetrical DAPY comprises both a propargyl and homopropargyl amine. DAPY was synthesized and tested as a substrate of two plant CAOs. DAPY acts as a mechanism-based inhibitor of the ... mixed with an excess of GPAO (5 mg, added as a concentrated solution in the same buffer) and the mixture was incubated at 30 °C for 12 h. After that, th...

Ngày tải lên: 19/02/2014, 16:20

13 604 0
Từ khóa:
w