Báo cáo khoa học: Solubility-dependent structural formation of a 25-residue, natively unfolded protein, induced by addition of a seven-residue peptide fragment pot
Báo cáo khoa học: Solubility-dependent structural formation of a 25-residue, natively unfolded protein, induced by addition of a seven-residue peptide fragment pot
... formation of a 25-residue, natively unfolded protein, induced by addition of a seven-residue peptide fragment Mitsugu Araki and Atsuo Tamura Graduate School of Science, Kobe University, Nada, Japan In ... 7801–7809. 15 Araki M & Tamura A (2007) Transformation of an alpha-helix peptide into a beta-hairpin induced by addi- tion of a fragment...
Ngày tải lên: 29/03/2014, 23:20
Tài liệu Báo cáo khoa học: NMR structural characterization of HIV-1 virus protein U cytoplasmic domain in the presence of dodecylphosphatidylcholine micelles doc
... the aqueous buffer. Qualitative analysis of secondary chemical shift and paramagnetic relaxation enhancement data in conjunction with dynamic information from heteronuclear NOEs and structural ... the calculated structures was acceptable; 89% of the analysed backbone torsions fell into the most favoured and additionally allowed regions of the Rama- chandran plot. An additional 6% of...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf
... Michigami T, Yamamoto T, Yasui N, Satomura K, Yamagata M, Shima M, Nakajima S, Mushiake S, Okada S & Ozono K (1998) Analysis of localization of mutated tissue-nonspecific alkaline phosphatase ... fraction). BSA (b, 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase (250 kDa) were loaded on to a separate gradient as mole- cular mass markers. K. Komaru et al. Novel aggregate fo...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: Amyloid oligomers: formation and toxicity of Ab oligomers ppt
... Saitama, Japan 2 PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama, Japan Introduction Alzheimer’s disease (AD) is an age-related, progressive degenerative disorder characterized by ... via a pathway distinct from that of fibril Fig. 1. Formation and toxicity mechanisms of extracellular Ab oligomers. Ab is released extracellularly as a product of proteolytically cle...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: The structural basis for catalytic function of GMD and RMD, two closely related enzymes from the GDP-D-rhamnose biosynthesis pathway pdf
... thermoaerophilus were amplified from chromosomal DNA templates, using the following primer pairs: P. aeruginosa,5¢-AGGCCCGCTTC C GGATCCACTCAGCGTCTG-3¢ and 5¢-AAAAAAGTCG ACTTCTTCTCGTACCCGTGACTC-3¢; and A. thermo- aerophilus,5¢-TT GGATCCATGAGAGCCCTAATCACTG GA-3¢ ... collected at a wavelength of 1.0 A ˚ on a MAR CCD detector at the Advanced Photon Source Beamline 5-ID (DND) (Argonne Nati...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx
... 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTC ACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTC ATCGTCTTT GTAGTCC ... the annealed fragment of the synthesized oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTG...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Nitric oxide formation from the reaction of nitrite with carp and rabbit hemoglobin at intermediate oxygen saturations pdf
... oxygenated carp Hb at 100% So 2 was clearly autocatalytic. The reac- tion rate initially showed a sharp increase, reached a marked peak and then displayed a decrease, as the reaction approached ... small amounts and disappeared com- pletely when the reaction entered the autocatalytic phase (Fig. 3D). Reaction in presence of ATP The addition of ATP to carp Hb at an [ATP] ⁄ [Hb] rat...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: The structural basis of calpain behavior pptx
... (l-cal- pain or calpain 1) and milli-calpain (m-calpain or calpain 2), have been the focus of three decades of intensive characterization. In vitro analysis has shown that the Ca 2+ concentration ... stars). This Ca 2+ -free configuration corresponds to a structurally inactive conformation of calpain 2. DIII is related to the spatial organization of the C2 domain and binds Ca 2+ ions...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: The structural comparison of the bacterial PepX and human DPP-IV reveals sites for the design of inhibitors of PepX activity pot
... against the X-PDAP of pathogens would probably affect the activity of the mammalian enzymes, leading to harmful consequences for human health. Taking advantage of the structural differences and ... 1.70 a Tests carried out on DPP-IV to validate the computational protocol of AUTODOCK. b Mean of values calculated by AUTODOCK 3.0. c Mean of the rmsd calculated between the solut...
Ngày tải lên: 23/03/2014, 13:20
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf
... precisely, an Fig. 4. N-terminal pegylation of G37 2A- FVIIa and FVIIa. (A) Pegyla- tion of free and TF-bound G37 2A- FVIIa and FVIIa visualized by SDS–PAGE. At each time point, a 12 lL aliquot of the reaction ... (Protein Data Bank accession number 1j 8a) with Asn in this position, albeit with F,W angles far from the allowed Ramachandran region, are virtually identical to that of...
Ngày tải lên: 18/02/2014, 08:20