Agriculture, Forestry, and Fishing Research at NIOSH Reviews of Research Programs of the National Institute for Occupational Safety and Health pptx
Agriculture, Forestry, and Fishing Research at NIOSH Reviews of Research Programs of the National Institute for Occupational Safety and Health pptx
... r o n y m s NIFS National Institute for Farm Safety NIH National Institutes of Health NIOSH National Institute for Occupational Safety and Health NORA National Occupational Research Agenda NPFVOA ... Forestry, and Fishing Research at NIOSH Reviews of Research Programs of the National Institute for Occupational Safety and...
Ngày tải lên: 29/03/2014, 13:20
Traumatic Injury Research at NIOSH Reviews of Research Programs of the National Institute for Occupational Safety and Health docx
... National Institutes of Health NIMS National Incident Management System NIOSH National Institute for Occupational Safety and Health NOIRS National Occupational Injury Research Symposia NORA National ... Population Health and Public Health Practice Traumatic Injury Research at NIOSH Reviews of Research Programs of the National Institute...
Ngày tải lên: 29/03/2014, 13:20
Tài liệu Reversed Food Chain – From the Plate to the Farm Priorities in Food Safety and Food Technology for European Research potx
... post-processing, and distribution to the end consumer. Therefore it’s essential to have at the beginning an idea of the current state of the art of the sector and the main developments along the food chain at ... increase research efficiency. Especially in the context of food safety, research results represent the foundation for the 15 implementation...
Ngày tải lên: 22/02/2014, 05:20
Postgraduate Research Opportunities at the Telethon Institute for Child Health Research: Student project booklet 2013 docx
... SERVICES 24 Title of Project Evaluations of virtualmachineperformance for NextGenerationSequencing platforms Key Research Area Bioinformatics and dataservices Research Group Bioinformatics StartDate ... aliated with UWA through the Centre for Child Health Research and with the state’s other four universies. You can nd out more about areas of research and opp...
Ngày tải lên: 07/03/2014, 04:20
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
... al. [19] mutated the putative zinc ligands, putative substrate-binding residues and other amino acids situated in the vicinity of these residues. The results confirmed the importance of the amino ... min/72 °C ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT 44/716 AAACTCGAGAGATCTAAATCCTCCAATGAAGC 30 s/94 °C; 1 min/56 °C; 4 min/72 °C AAACTCGAGTTATTATTCAATATCAAACAGAG 59/750 AAAAGATCTAAAGCAT...
Ngày tải lên: 07/03/2014, 15:20
Safe and Effective Medicines for Children: Studies Conducted Under the Best Pharmaceuticals for Children Act and the Pediatric Research Equity Act potx
... including the use of medications with neonates and the long-term safety and effectiveness of drugs for all pediatric age groups. The frequent lack of information about the long-term safety of drugs ... dissemination of labeling information from studies conducted under BPCA and PREA, including both the speed of dissemination and the accuracy and comple...
Ngày tải lên: 23/03/2014, 00:20
A Collaborative Project of The Mickey Leland National Urban Air Toxics Research Center and The National Center for Health Statistics pot
... VOCs and Behavioral, Socioeconomic, and Demographic Characteristics A Collaborative Project of The Mickey Leland National Urban Air Toxics Research Center and The National Center for Health Statistics NUMBER ... Environment International 34 (2008) 922–931 The National Health and Nutrition Examination Surveys (NHANES) Volatile Organic Compound Dataset: An Introdu...
Ngày tải lên: 28/03/2014, 19:20
Genotoxicity of 255 chemicals in the Salmonella microsome test (Ames test) and 8-hydroxyguanine (8-OH-Gua) assay for the detection of carcinogens
... YG3003 and/ or YG7108 strain, and 21 chemicals (8.2%) formed 8-OH-Gua in the rat hepatocytes oxidized DNA. These results may demonstrate the utility and limitation of both the Ames test and 8-OH-Gua ... correlation between mutagenicity in the Ames test and carcinogenicity in the animal tests (Sugimura 1986). 8-OH-Gua is one of the most popular markers for the eval...
Ngày tải lên: 05/09/2013, 08:40
Analysis of Phosphorus Behavior in the Giant Reed for Phytoremediation and the Biomass Production System
... from the fluorescent lamp to the top of the giant reeds was about 0.2 m at the start of the experiment. The temperature in the experimental room was kept at about 28 °C. The rhizomes and the ... the above-ground part of the giant reeds that will remain the following year are cropped before the start of the dying down period. Then, after all of t...
Ngày tải lên: 05/09/2013, 09:38
Tài liệu Analysing Commitments to Advance the Global Strategy for Women’s and Children’s Health pdf
... Pirozzi. The designations employed and the presentation of the material in this publication do not imply the expression of any opinion whatsoever on the part of the World Health Organization concerning ... Improving integration across the MDGs The Global Strategy recognizes that the health of women and children depends on progress made towards achieving a...
Ngày tải lên: 12/02/2014, 12:20