Báo cáo khoa học: Trypanosoma brucei: a model micro-organism to study eukaryotic phospholipid biosynthesis docx

... M, Hashida-Okado T, Yasumoto R, Gomi K, Kato I & Takesako K (1999) An aureobasidin A resis- tance gene isolated from Aspergillus is a homolog of yeast AUR1, a gene responsible for inositol ... and Molecular Medicine, University of Bern, Switzerland Introduction Trypanosoma brucei is a eukaryotic protozoan parasite causing African sleeping sickness in humans and nagana in domes...

Ngày tải lên: 28/03/2014, 23:20

... A 1227 bp genomic clone was obtained by PCR amplification with the forward primer 5¢-CG GGATCCATGTTGCCTAAGCAACAGATG-3¢ and the reverse primer 5¢-CCC AAGCTTAACTGCGAG TAATGCAGAT-3¢ containing BamHI ... degree and type of fatty acid desaturation between trypanosomes and their mammalian host, indicate that fatty acid desaturases may be good targets for trypanocidal drugs. Fatty acid desaturases...

Ngày tải lên: 23/03/2014, 12:20

... positive cases), but has a low recall (many false negative cases). Any sequence with a variation is ignored by the automata and it is difficult to get exhaustive adjective and verb semantic classes 2 . ... representation. 3 A Bayesian Network Based System Contain No−Contain Contain−Known−Noun Anaphoric−It Non−anaphoric−It Pronoun Star No−Start Start−Proposition Start No−Start Start−Sen...

Ngày tải lên: 17/03/2014, 22:20

... syntax and semantics and that of the clause. References Nicholas Asher and Alex Lascarides. 1999. The semantics and pragmatics of presupposition. Journal of Semantics, to appear. Dan Cristea ... (2c) are the assertions that the situation associated with B is a cause for that associated with A and that the situ- ation associated with B is one of a set of such causes. Finally,...

Ngày tải lên: 20/02/2014, 18:20

... 5¢-TAATTTAAAAGCCGTTGTATCCTTTGGT GAATCTT-3¢; C12 6A, 5¢-TAATTTAAAAGCCGTTGT AGCTTTTGGTGAATCTT-3¢; C126V, 5¢-TAATTTAAAA GCCGTTGTAGTTTTTGGTGAATCTT-3¢; C126M, 5¢-T AATTTAAAAGCCGTTGTAATGTTTGGTGAATCTT-5¢; and ... site-specific mutagenesis – distal effects on dimer stability Moumita Samanta 1 , Mousumi Banerjee 1 , Mathur R. N. Murthy 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Bioph...

Ngày tải lên: 14/03/2014, 23:20

... disciplines as multi-scalar analysis, of which fractal analysis is a variant. Although a certain amount has been written about the fractal or hierarchical nature of language, approaches to co-occurrence ... generate a probabilistic language model, where previously n-gram models have been used, The allusion to proximity as a fundamental indicator of lexical association does...

Ngày tải lên: 24/03/2014, 03:20

... the table we have also included a ran- dom, a maximum (always pick the best transla- tion according to humans) and a minimum (al- ways pick the worse translation according to hu- man) OST for all 4 . ... met- ric variants at three linguistic levels: lexical, syn- tactic, and semantic. In all cases, translation qual- ity is measured by comparing automatic transla- tions against a s...

Ngày tải lên: 20/02/2014, 07:20

... self-training for parser adaptation. In Proceedings of ACL. D. McClosky, E. Charniak, and M. Johnson. 2010. Au- tomatic Domain Adapatation for Parsing. In Proceed- ings of NAACL-HLT. R. McDonald and ... largest data set that is available for NLP (Keller and Lap- ata, 2003). Another is a web-scale N-gram corpus, which is a N-gram corpus with N-grams of length 1- 5 (Brants and Franz, 2006),...

Ngày tải lên: 30/03/2014, 21:20

... GTCGACCTGCAGCCCAAGCTTGCGTTGCTG A- flap ATGTGGAAAATCTCTAGCAGGCTGCAGGTC GAC B-flap CAGCAACGCAAGCTTGATGTGGAAAATCTCT AGCA B-g1 CAGCAACGCAAGCTT B-g2 CAGCAACGCAAGCT B-g4 CAGCAACGCAAG A- b15 AGAGATTTTCCACAT A- b17 CTAGAGATTTTCCACAT A- b19 ... CGGGTCAACGTGGGCAAAGATGTCCTAGCAA TGTAATCGTCTATGACGTC X3 GACGTCATAGACGATTACATTGCTAGGACA TGCTGTCTAGAGACTATCGC X4 GCGATAGTCTCTAGACAGCATGTCCTAGCAA GCCAGAATTCGGCAG...

Ngày tải lên: 07/03/2014, 10:20

... NAD + k 5 [ACA] [NADH] ATPase: ATP fi ADP k 6 [ATP] storage: Glc + 2 ATP fi 2 ADP k 7 [Glc] [ATP] glycerol: trioseP + NADH fi NAD + k 8 [trioseP] [NADH] difACA: ACA Ð ACA x k 9 ([ACA] ) [ACA x ]) outACA: ACA x fi ... by means of mathematical models with varying degrees of detail. A primary advantage of a detailed, biochemically formulated model is that a one -to- one comparison can be mad...

Ngày tải lên: 07/03/2014, 11:20