Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot

Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot

Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot

... with stems being marked by cyan bars and the RNase-accessible joint and loop regions by red bars. (D) RNase footprinting analysis of products from the ribonuclease cleavage of the M3 mutant RNA < /b> of ... whereas cleavage signals by RNase T1 and RNase A < /b> are exclusively located in < /b> the unpaired loop and joint regions, including some weak signals near the bulged U at ste...

Ngày tải lên: 28/03/2014, 23:20

14 379 0
Báo cáo y học: "Enhanced surveillance for childhood hepatitis B virus infection in Canada, 1999-2003"

Báo cáo y học: "Enhanced surveillance for childhood hepatitis B virus infection in Canada, 1999-2003"

... Public Health Agency of Canada, Winnipeg, MB, Canada 3 Capital Health, Edmonton, AB, Canada 4 Calgary Health Region, Calgary, AB, Canada 5 City of Ottawa, Public Health and Long Term Care Branch, ... for Infectious Disease Prevention and Control, Public Health Agency of Canada, Ottawa, ON, Canada 2 National Microbiology Laboratory, Canadian Science Centre for Human and Animal Heal...

Ngày tải lên: 02/11/2012, 11:08

4 399 0
Báo cáo y học: "Epidemiology and Prevention of Hepatitis B Virus Infection"

Báo cáo y học: "Epidemiology and Prevention of Hepatitis B Virus Infection"

... endemicity areas, particularly in < /b> China and Southeast Asia. Before HBV vaccine was integrated into the routine immunization program, the proportion of babies that become HBV carriers is about 10-30% ... therapy and disease progress. 6. HBeAg-negative CHB HBeAg-negative chronic hepatitis < /b> B (e-CHB), characterized by HBV DNA levels detectable by nonamplified assays and...

Ngày tải lên: 02/11/2012, 11:12

8 643 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... kDa), apoferritin (440 kDa), catalase (230 kDa), alcohol dehydrogenase (150 kDa), con- albumin (78 kDa), albumin (66 kDa), and b- lactoglobulin (35 kDa). In < /b> the experiment testing the stability ... mitochondrial mem- branes from wild-type (WT) and D QCR10 yeast strains by BN ⁄ PAGE and SDS ⁄ PAGE. (A)< /b> Mitochondrial membranes were analyzed by BN ⁄ PAGE, as described in <...

Ngày tải lên: 18/02/2014, 08:20

15 640 0
Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

... Sepuri, Sanjay Yadav, Hindupur K. Anandatheerthavarada and Narayan G. Avadhani Department of Animal Biology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, PA, USA Cytochrome ... Pennsylvania. Journal compilation ª 2007 FEBS 9 Boopathi E, Anandatheerthavarada HK, Bhagwat SV, Biswas G, Fang JK & Avadhani NG (2000) Accumula- tion of mitochondrial P450MT2, NH(2)-t...

Ngày tải lên: 18/02/2014, 16:20

16 651 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan probe 18S TGGACCGGCGCAAGACGGAC AB Fig. ... rev, reverse. Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD re...

Ngày tải lên: 19/02/2014, 02:20

14 601 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

... o AthalianaB PativumB SoleraceaB NtabacumB A.< /b> thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus AthalianaB PativumB SoleraceaB NtabacumB A.< /b> thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus AthalianaB PativumB SoleraceaB NtabacumB A.< /b> thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus 119 119 119 119 119 120 119 121 118 119 15...

Ngày tải lên: 19/02/2014, 16:20

8 494 0
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

... 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ R11 4A < /b> 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ Y116D 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢ 5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢ Y. ... proteins in < /b> plants. Cell Stress Chaperones 8, 381– 394. 70 Rajaraman K, Raman B, Ramakrishna T & Rao CM (2001) Interaction of human recombinant aA...

Ngày tải lên: 07/03/2014, 12:20

15 516 0
Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot

Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot

... 5¢-GGAATTCAG TGGAAAAACTTTACAT-3¢ for XPR130, the primers 5¢-GTTCCTGAGCAAAGTCTTCAATG-3¢ and 5¢-GG AATTCAGTGGAAAAACTTTACAT-3¢ for XN73, and the primers 5¢-GGAATTCATGCCGACCACAACCGTT TTAAG-3¢ and ... CTTCAGgtaatt 185761 tttcagGATGTG 6 75 ACCACGgtaggc 7814 aaccagGTTATT 7 87 TTGCAAgtatgc 3811 tttcagACCCTA 8 157 ACCAGGgtaagt 5461 atttagCTTCAT 9 49 AACAAGgtaaga 2646 ctttagGGGAAA 10 90 TACCAGgta...

Ngày tải lên: 08/03/2014, 08:20

12 507 0
Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp. PCC 6803 ppt

Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp. PCC 6803 ppt

... amplified by PCR, using primers 5¢-ATTTCGATCATGCAGGCCG-3¢ and 5¢-GGAAGAAC CGTGCATTACC-3¢, and labeled with [a-< /b> 32 P]dCTP using a < /b> Megaprime labeling kit (Amersham Pharmacia, Piscataway, NJ, USA). Hybridization ... possibility that some HTH DNA-binding proteins may be involved in < /b> the fbaA gene expression induced by light and glucose. We have searched the Synechocystis...

Ngày tải lên: 16/03/2014, 04:20

12 395 0
w