Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc

... for the treatment of stress urinary incontinence in women: a systematic review Patricia B Neumann 1 , Karen A Grimmer* 2 and Yamini Deenadayalan 3 Address: 1 PhD candidate, School of Health ... University of South Australia, Adelaide, Australia Email: Patricia B Neumann - cpneumann@ozemail.com.au; Karen A Grimmer* - karen.grimmer@unisa.edu.au; Yamini Deen...

Ngày tải lên: 28/03/2014, 14:20

... combine both reporting and training in a single session. In fact, some of the best “stealth training can be delivered in the context of a Board report. For instance, while reviewing the status ... of the C&E program? What is the method and frequency of C&E reporting to the board, and of board contact with the CECO? 4. How will the boa...

Ngày tải lên: 08/03/2014, 16:20

... extrapolated from data in the RCT. The survival of patients receiving ASC/BSC was calculated from the survival of the patients in the cetuximab monotherapy arm of the RCT. The data from the ... comparators in the studies cannot be considered current standard practice in the NHS in England and Wales because the 5-FU treatment schedules involved admi...

Ngày tải lên: 14/02/2014, 22:20

... sources Page 24 CURRENT APPROACHES TO THE TEACHING OF READING IN AUSTRALIA 16 A more detailed analysis of the philosophy and practice of whole language teaching in Australia and New Zealand is ... holistic and whole language approaches to the teaching of reading from approaches based on skill-based or direct teaching models. The dominance of a single approach...

Ngày tải lên: 17/02/2014, 06:20

... a- T, TA and TN (Figs 3 and 4), but not of the antioxidants BHA and AsA. These results suggested that active oxygens and free radicals did not participate in the TS effect, and that the inhibitory ... 378S– 381S. 7. Badamchian, M., Spangelo, B.L., Bao, Y., Hagiwara, Y., Hagiwara, H., Ueyama, H. & Goldstein, A. L. (1994) Isolation of a vitamin E analog from a gr...

Ngày tải lên: 22/02/2014, 04:20

... the treatment of chronic back pain originating in the facet joint. MATERIALS AND METHODS Patient enrollment and evaluation All patients treated with endoscopic facet de- bridement at our institution ... Length of fol- low-up was at least 3 years with a maximum of 6 years. Location of facet pain was cervical in 45, tho- racic in 15, and lumbar in 114 patients...

Ngày tải lên: 26/10/2012, 09:32

... or foraminal, refractory to conservative management is uncertain. We aimed to evaluate the efficacy of endoscopic laminoforamino- plasty (ELFP) in the treatment of thoracic radiculopathy. Methods: ... 225 central or foraminal stenosis treated with endoscopic laminoforaminoplasty via a small incision, of less than one inch. Materials and Methods Twelve patients were tr...

Ngày tải lên: 26/10/2012, 09:57

... 2003. The effective reactor consisted of 45L of anoxic tank and 135L of aerobic tank, and a sedimentation tank. Influent was 60L/day. pH was 8.0-8.5 in the anoxic tank, and 7.0-7.5 in the aerobic ... to nawwor down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed...

Ngày tải lên: 05/09/2013, 09:38

... which affect China’s environmental quality and the sustainable development. Municipal wastewater treatment in China faces serious shortage of financing and land area. Thus, considering the municipal ... NH 4 + -N removal and ±15% fluctuation in the PO 4 3- -P removal. An increase in the recycle ratio resulted in an increase in the COD removal and an increase...

Ngày tải lên: 05/09/2013, 09:38

... about the interactions between hydroxyurea and these underlying diseases, and between hydroxyurea and therapies for these diseases. Further research on the place of hydroxyurea in therapy and ... guidelines regarding its use, the National Institutes of Health Office of Medical Applications of Research (OMAR) and the Agency for Healthcare Research and Qual...

Ngày tải lên: 05/03/2014, 10:20