Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc

... for the treatment of stress urinary incontinence in women: a systematic review Patricia B Neumann1, Karen A Grimmer*2 and Yamini Deenadayalan3Address: 1PhD candidate, School of Health ... University of South Australia, Adelaide, AustraliaEmail: Patricia B Neumann - cpneumann@ozemail.com.au; Karen A Grimmer* - karen.grimmer@unisa.edu.au; Yamini Deenadayalan - yamini.deenadayalan@unisa.edu.au* ... community-dwelling women over the age of 18 years in Australia [3]. The personal financial costs for women managing UI in Australia in 1998 were estimated at A$ 372 million perannum and the total annual...

Board Engagement, Training and Reporting: Strategies for the Chief Ethics and Compliance Officer pptx

... combine both reporting and training in a single session. In fact, some of the best “stealth training can be delivered in the context of a Board report. For instance, while reviewing the status ... of the C&E program? What is the method and frequency of C&E reporting to the board, and of board contact with the CECO? 4. How will the board obtain and evaluate the appropriate training ... environmental have always brought important data to the Board and it is at the heart of the Board’s role to review and evaluate the data, ask hard questions. The focus should be: 1) what does the board...

Tài liệu Bevacizumab and cetuximab for the treatment of metastatic colorectal cancer docx

... extrapolated from data in the RCT. The survival of patients receiving ASC/BSC was calculated from the survival of the patients in the cetuximab monotherapy arm of the RCT. The data from the ... comparators in the studies cannot be considered current standard practice in the NHS in England and Wales because the 5-FU treatment schedules involved administration by bolus rather than administration ... largest study was lower than the age of patients normally receiving chemotherapy in England and Wales. However, clinical specialists agreed that fitness, rather than age, is the primary factor...

Tài liệu Closing the gap between research and practice: Foundations for the acquisition of literacy pptx

... sourcesPage24CURRENT APPROACHES TO THE TEACHING OF READING IN AUSTRALIA16 A more detailed analysis of the philosophy and practice of whole language teaching in Australia and NewZealand is ... holistic and wholelanguage approaches to the teaching of reading from approaches based on skill-based or direct teaching models. The dominance of a single approach to the teaching of reading in Australia ... towhich the impact of this seminar and the research traditions it authoriseddominated Australian language and Page10FOCUS OF AUSTRALIAN RESEARCH INTOLANGUAGE AND LITERACY3It is of some interest...

46
1,122
0

Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

... a- T, TA and TN (Figs 3 and 4), butnot of the antioxidants BHA and AsA. These resultssuggested that active oxygens and free radicals did notparticipate in the TS effect, and that the inhibitory ... 378S–381S.7. Badamchian, M., Spangelo, B.L., Bao, Y., Hagiwara, Y.,Hagiwara, H., Ueyama, H. & Goldstein, A. L. (1994) Isolation of a vitamin E analog from a green barley leaf extract that stimulatesrelease ... cellsKentaro Kogure, Motoki Morita, Susumu Hama, Sawa Nakashima, Akira Tokumura and Kenji Fukuzawa1Faculty of Pharmaceutical Sciences, University of Tokushima, Japan The eﬀect of a- tocopheryl...

Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

... the treatment of chronic back pain originating in the facet joint. MATERIALS AND METHODS Patient enrollment and evaluation All patients treated with endoscopic facet de-bridement at our institution ... Length of fol-low-up was at least 3 years with a maximum of 6 years. Location of facet pain was cervical in 45, tho-racic in 15, and lumbar in 114 patients. Surgical times varied based on the ... compared to radiofrequency ablation of the dorsal nerve branch, with durable results. Large scale, randomized trials are warranted to further evaluate the relative efficacy of this surgical treatment...

Báo cáo y học: "Endoscopic thoracic laminoforaminoplasty for the treatment of thoracic radiculopathy: report of 12 case"

... or foraminal, refractory to conservative management is uncertain. We aimed to evaluate the efficacy of endoscopic laminoforamino-plasty (ELFP) in the treatment of thoracic radiculopathy. Methods: ... 225central or foraminal stenosis treated with endoscopic laminoforaminoplasty via a small incision, of less than one inch. Materials and Methods Twelve patients were treated with endoscopic laminoforaminoplasty ... radiculopathy, laminoforaminoplasty, minimally invasive, endoscopic, spi-nal stenosis Introduction Radicular back pain is an important public health issue that can result in long term disability and...

Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater

... 2003. The effective reactor consisted of 45L of anoxic tank and 135L of aerobic tank, and a sedimentation tank. Influent was 60L/day. pH was 8.0-8.5 in the anoxic tank, and 7.0-7.5 in the aerobic ... to nawwor down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter ... FISH analysis and was stored at -80oC. The extraction of DNA was performed with Fast DNA SPIN Kit for Soil (Qbuiogene, USA) according to the instruction by the manufacturer. In the preliminary...

Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater

... which affect China’s environmental quality and the sustainable development. Municipal wastewater treatment in China faces serious shortage of financing and land area. Thus, considering the municipal ... NH4+-N removal and ±15% fluctuation in the PO43--P removal. An increase in the recycle ratio resulted in an increase in the COD removal and an increase in NH4+-N and PO43--P removals (Fig. ... tank. From an engineering application point of view, the appropriate operational parameters of the recycle ratio, HRT of the regeneration tank, HRT of the adsorption tank and SRT of the system...

Hydroxyurea for the Treatment of Sickle Cell Disease docx

... about the interactions between hydroxyurea and these underlying diseases, and between hydroxyurea and therapies for these diseases. Further research on the place of hydroxyurea in therapy and ... guidelines regarding its use, the National Institutes of Health Office of Medical Applications of Research (OMAR) and the Agency for Healthcare Research and Quality (AHRQ) requested that the ... pathways that are not yet fully characterized. One pathway is probably saturable hepatic metabolism, and another minor pathway may involve degradation by the urease found in intestinal bacteria....

298
1,113
0

Xem thêm

Từ khóa: novel alternative therapies for the treatment of severe aortic stenosis cpg dna based therapies for the treatment of allergic disease 1 25 dihydroxyvitamin d3 and its analogues for the treatment of psoriasis medical non surgical therapies for the treatment of angina pectoris leal y a flores l l garcía cortés l b cedillo rivera r and torres j 2008 antibody based detection tests for the diagnosis of helicobacter pylori infection in children a meta analysis plos one 3 e3751 pelvic floor muscle training sacral nerve root stimulation for the treatment of pelvic and rectal pain fetal and environmental basis for the cause of parkinson s disease 3a program and project management for the acquisition of capital assets and doe m 413 3 1 project management for the acquisition of capital assets and doe std 1189 2008 integration of safety into the design process lipid involvement in viral infections present and future perspectives for the design of antivir neuronal insulin receptor signaling a potential target for the treatment of cognitive and mood adalimumab etanercept and infliximab for the treatment of rheumatoid arthritis nice technology appraisal guidance 130 and old strategies for the design of antibacterial screening libraries medication development for the treatment of cocaine addiction progress at preclinical and clin proposals for the treatment of users of alcohol and other drugs a psychoanalytic reading Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Chuong 2 nhận dạng rui ro Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ