The preference of a Female Greek island population in regard to the gender of their gynecologist pdf
The preference of a Female Greek island population in regard to the gender of their gynecologist pdf
... model, in which we included the variables that initially correlated with the choice of the sex and The preference of a Female Greek island population in regard to the gender of their gynecologist ... reported that they preferred a female doctor to take their Pap smear, 48% that they preferred a woman for their breast exam and 36% that...
Ngày tải lên: 28/03/2014, 14:20
Báo cáo khoa học: Covalent activation of heart AMP-activated protein kinase in response to physiological concentrations of long-chain fatty acids docx
... activities of the a- 1 or the a- 2 isoforms of AMP- activated protein kinase (AMPK), increased phosphoryla- tion of acetyl-CoA carboxylase and a decrease in the tissue content of malonyl-CoA. Activation ... seen. A covalent activation leading to phosphorylation/inac- tivation of ACC, decreased malonyl-CoA and activation of CPT1 provides a novel insight into ways...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk
... results of these initial trials indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary ar- tery disease (CAD; 4). Also the ... acti- vated and clotting time of 250 to 300 s. Patients re- ceived intracoronary nitroglycerin (0.1 to 0.2 mg) to achieve maximal vasodilatation before undergoing their...
Ngày tải lên: 25/10/2012, 11:18
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
... mentioned ear- lier, the loss of dopaminergic neurons in substantia nigra is a neuropathological hallmark of Parkinson’s disease. This leads to a decreased level of dopamine in the striatum. As a result, ... evidence that MPTP and MPP + can facilitate aggregation of a- synuclein in the absence of any cellular machinery. It has been proposed that the auto-oxida...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
... o AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus 119 119 119 119 119 120 119 121 118 119 159 159 159 159 157...
Ngày tải lên: 19/02/2014, 16:20
Campaigns of a Non-Combatant, and His Romaunt Abroad During the War ppt
... this individual was troubled with a kind of insanity peculiar to all headquarters, arising out of an exaggerated idea of his own importance. I had the pleasure, a few minutes afterward, of hearing ... the curling smoke of their pickets, a few miles away. The cleft of Manassas was plainly visible, and I traced the line of the Gap Railway to its junction with...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTG...
Ngày tải lên: 07/03/2014, 16:20
Review of the Need for a Large- scale Test Facility for Research on the Effects of Extreme Winds on Structures pptx
... speeds and characteristics can be caused by changes in elevation and by averaging time associated with a particular observation, as well as the topography and roughness of the upwind terrain. In an ... being made in a number of areas, such as the characterization of wind fields and the evaluation of the performance of the building envelope (AAWE, 199 7a) . Two...
Ngày tải lên: 08/03/2014, 19:20
Báo cáo khoa học: A di-leucine sorting signal in ZIP1 (SLC39A1) mediates endocytosis of the protein doc
... signal(s) mediating the ZIP1 exocytotic arm of trafficking remains to be mapped. The [DE]XXXL[LI] signals in mammalian proteins mediate rapid internalization and targeting to endo- somal–lysosomal ... (Fig. 1A) . The di-leucine signal at amino acids 179–184 and the tyrosine-based signal at amino acids 285–288 are located within the predicted transmembrane domains that make th...
Ngày tải lên: 16/03/2014, 11:20
Báo cáo khoa học: A new rice zinc-finger protein binds to the O2S box of the a-amylase gene promoter pptx
... the amino acids within the binding domain of RAMY protein and analyzed the time course for the induction of RAMY a nd a- amylase mRNA by GA. Correspondence to Q. Yao, Shanghai Key Laboratory of Agricultural Genetic ... copies of O2S was synthesized by PCR using two primers: Amyb1: 5¢-ACCCTCGAGGTCGA CGGTATCGATAAGCTTGATTGACTTGACCGTCA TCGGATTGACTTGACCGTCATCG-3¢,Amyb2:5¢-CA G...
Ngày tải lên: 16/03/2014, 18:20