Symptomatology of Gynecological Malignancies: Experiences in the Gynecology Out-Patient Clinic of a Tertiary Care Hospital in Kolkata, India pot

... Gynecology Out-Patient Clinic of a Tertiary Care Hospital in Kolkata, India Madhutandra Sarkar 1, 2* , Hiralal Konar 3 , DK Raut 4 Madhutandra Sarkar et al Asian Pacic Journal of Cancer Prevention, ... presenting symptom among the patients of ovarian cancer in a hospital of Nigeria. Sultana and Kiyani (2005) in their study conducted in a hospital...

Ngày tải lên: 28/03/2014, 14:20

... Patients in a Tertiary Care Hospital in India Madhutandra Sarkar 1 *, Hiralal Konar 2 , DK Raut 3 of the cervical cancer cases occur in the developing countries (Sankaranarayanan & Ferlay, ... years while that for ovarian carcinoma 46.4 years and endometrial carcinoma 56.0 years. A study done in Larkana, Pakistan (Siyal et al., 1999) had reported that the av...

Ngày tải lên: 22/03/2014, 11:20

... application interval was 31.4 days, mean referral interval was 22.1 days, mean diagnosis interval was 3.3 days, and mean initiation of treatment interval was 1.4 days. Patient delay was present in 34.8 ... A previous report indicated that 28.4 percent of the patients had patient delay and that the median application interval was 17.5 days [14]. The rate of patient delay was sl...

Ngày tải lên: 22/03/2014, 18:20

... fits the data. It indicates the amount of the relationship between the variables that remains unex- plained by a model; the larger the value, the poorer the model fits the data. As a rule of thumb, ... Reference Standards Using Data from a Tertiary Care Centre in Rwanda Mugabekazi Julie 1 , Boelaert Marleen 2 , Sarushi Joseph 1 , Seruyange Eric 1 , Basinga P...

Ngày tải lên: 22/03/2014, 18:20

... determine the knowledge, attitudes and practices of specialist physicians in a tertiary care hospital as to: a. their idea of the magnitude of TB problem in the Philippines b. their opinion of the ... tertiary care hospital as St. Luke’s realize the magnitude of TB problem in the country. However, the majority does not favorably rate the National...

Ngày tải lên: 15/03/2014, 03:20

... quantity of the sample in each tube was the same. Amount of amoA mRNA increased in all runs after starting the experiment. The highest amount of amoA mRNA was observed in control at 200 min ... oxidizing activity. This low amount of amoA mRNA in Run 2 should be related to the fact that 40% of ammonia remained at the end of batch experiment. Small decrease i...

Ngày tải lên: 05/09/2013, 10:15

... approaches  APEC and the MRCWG have a role in liaising with IMO, FAO, NACA to enhance the effectiveness of existing instruments within APEC  Institutional arrangements for managing the marine ... Management Framework - Introd uced Marine Pests Priorities and hazards for Economies  Variable levels of activity and management capability  Ships’ ballast water and hull...

Ngày tải lên: 28/10/2013, 11:15

... 2003. The adoption of organic agriculture among small farmers in Latin America and the Caribbean: Thematic evaluation. Rome, IFAD. April 2003. Report No. 1337. IFAD, 2005. Organic agriculture and ... organic industry in South Africa is relatively new and the domestic market is limited in the variety of organic products available. In South Africa, food retailers have t...

Ngày tải lên: 14/02/2014, 03:20

... TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a GSP-...

Ngày tải lên: 14/02/2014, 14:20