Hallmarks of a sustainable city pdf
Hallmarks of a sustainable city pdf
... network and the capacity of foul and surface water drainage and river catchments, and levels of water availability and consumption, to see how they can accommodate the future impacts of climate change. ... will force a reappraisal of what actually creates land value. The presence of sustainable infrastructure could be one of the most compelling offers that a town or city...
Ngày tải lên: 24/03/2014, 21:20
Tài liệu Anatomy of a Robot P2 pdf
... that making the actuator gain as large as possible is desireable. Just be aware that increasing the gain of the actuator adds expense and will adversely affect the dynamic (nonsteady state) behavior ... behavior of the control system as we will see later. In the worst case, a large actuator gain can make the system unstable and lead to failures. Whenever altering the gain, remember to r...
Ngày tải lên: 19/01/2014, 20:20
Tài liệu Improving Child Health in Cambodia: Social Marketing of Diarrhea Treatment Kit, Results of a Pilot Project pdf
... critical in urban and peri-urban areas where caregiv- ers have more access to financial means and greater availability of alternative treatments. Lesson 4: The availability of anti-diarheal products ... in rural areas of Siem Reap and Pursat. The partnerships also facilitated an extensive training program of partners and providers on diarrheal disease, pre- vention, and treatment...
Ngày tải lên: 12/02/2014, 19:20
Tài liệu Autobiography of a Pocket-Handkerchief pdf
... particular are worthy of the capital of Europe, and they are open to all who can manage to make a decent appearance. Adrienne's hotel had a little garden in the rear, and she sat at her window ... half, and the place had, by no means, the appearance of that poverty which actually reigned within. Adrienne went through the ante-chamber, which served also as a salle a manger,...
Ngày tải lên: 18/02/2014, 09:20
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... mutagenesis reactions together with oligonucleo- tides ECF-Q69G d(5¢-AACAACGCAGCT GGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAAC CAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG C CAGCACGCTAACCAC) and ... 463–468. 9. Amano, A. , Shizukuishi, S., Tamagawa, H., Iwakura, K., Tsunasawa, S. & Tsunemitsu, A. (1990) Characterization of super- oxide dismutases purified from either anaerobically m...
Ngày tải lên: 21/02/2014, 01:21
Đề tài " The diameter of the isomorphism class of a Banach space " pdf
... Tomczak-Jaegermann, Banach-Mazur Distances and Finite-dimensional Opera- tor Ideals, Pitman Monographs and Surveys in Pure and Applied Mathematics 38, Longman Scientific & Technical, Harlow ... the lemma follows from Lemma 3 and the the classical fact that every separable Banach space 1-embeds into C[0, 1]. Lemma 4 is false for some nonseparable spaces. Partington [P] and Talagrand [T] ......
Ngày tải lên: 15/03/2014, 09:20
Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf
... occurs with natively folded GABARAP. This is clearly indi- cated by the NMR spectra of free GABARAP and of N1-liganded GABARAP after displacement of CRT. Both spectra are typical of a folded protein, and ... O’Hare T, Blackwell A & Enns CA (2002) Association of human transferrin receptor with GABA- RAP. FEBS Lett 518, 101–106. 13 Kanematsu T, Jang IS, Yamaguchi T, Nagahama H...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: "Development of a Stemming Algorithm" pdf
... with a very limited list of suffixes. Where stems are used as a means of associating re- lated items of information, as they are in an automated library catalogue, and where the catalogue can ... requires generating all possible combinations of affixes. A second disadvantage is the amount of stor- age space the endings require. The first disadvantage may also be present...
Ngày tải lên: 16/03/2014, 19:20
Danger! A True History of a Great City''''s Wiles and Temptations pot
... profession. As he had fluent command of the German language a useful adjunct to the practice of a criminal lawyer in New York and gave promise of attaining a high rank as an advocate, Mr. Howe made him ... ON CRIME AND ITS CAUSES, AND Danger! A True History of a Great City& apos;s by William Howe and Abraham Hummel 2 CHAPTER I. ANCIENT AND MODERN PRISONS. Some of the Cit...
Ngày tải lên: 17/03/2014, 20:20
Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf
... (Kansas City, KS, USA). Plasmids and cloning procedures For heterologous expression in yeast, N. crassa HEX1 was amplified from a N. crassa cDNA library using PCR with primer pair RE951 (AAGAATTCATGGGCTACTACGA CGAC) ... conditions For all plasmid amplifications and isolations Escherichia coli strain DH 5a was used (Invitrogen, Carlsbad, CA, USA). The yeast wild-type strain BY4742 was used....
Ngày tải lên: 23/03/2014, 07:20