Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

... Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt ( Osmerus mordax ) John C. Achenbach 1, * and K. Vanya Ewart 2 1 Department of Biochemistry ... may be relevant to the calculation of smelt AFP activity. The activity of smelt AFP is about one-third of that of sea raven AFP on a monomer concentra...

Ngày tải lên: 24/03/2014, 03:21

... data of A ˚ kerfeldt et al. [29] agrees with the large body of independent data collected on Calb and truncated Calbs by Kumar’s group. This latter work revealed that EF-hands II and VI of Calb ... products of CR I–II. We thank Walter Chazin (Vanderbilt University, Nashville) for critical evaluation of the manuscript and Barbara Zarzycka (Warsaw) for her technical assistance...

Ngày tải lên: 22/02/2014, 07:20

... [13]. Chromatographic analysis Gel-filtration analysis of pure calhepatin was performed as described by Drohat et al. [7] by FPLC on a Superose 12 HR 10/30 column (Pharmacia) calibrated with standard proteins. ... trifluoroacetic acid] over 80 min. Amino-acid analysis and sequencing Peptide amino-acid analyses and automatic amino-acid sequence determination by Edman degradation were car...

Ngày tải lên: 08/03/2014, 22:20

... efficiency of Iba1 and Iba2 or in the overall morphology of the generated filament bundles. Calcium affinity of Iba1 and Iba2 Homodimerization and actin binding of Iba1 and Iba2 were similar in the absence ... 1 and 2). The core of Iba2 is a pair of EF-hand motifs, denoted as EF-hands 1 and 2, each consisting of two a helices (aA, aB and aC, aD, respectively) flank...

Ngày tải lên: 16/03/2014, 06:20

... microscopy data for serotypes hAd3 and hAd12 and the crystallographic data for hAd2 raise the possibility that the hypervariable loop could possess secondary structural elements potentially important ... ¢-TCCGAAACCAGCG GCCGCTT TATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and the reverse oligomer 5¢-GTAGGCCTT TGAATTCCTCAAAA AGTGCGGCTCGAT-3¢ were used to introduce a Not1 site followed by th...

Ngày tải lên: 19/02/2014, 06:20

... the yeast two-hybrid assay and using a mammalian hybrid system (Invitrogen, Carlsbad, CA) (EDA Wheeler & V Ayyavoo, unpublished data). A blast search revealed that the IMAGE clone, localized ... contain a KH domain. RNA analysis and blast analysis indicated that homologs and orthologs of VBARP exist, indica- ting the presence of VBARP in diverse phyla such as plants, yeast...

Ngày tải lên: 07/03/2014, 21:20

... protein crystallography. Acta Crystallogr D Biol Crystallogr 50, 760–763. 31 Vagin A & Teplyakov A (2000) An approach to multi- copy search in molecular replacement. Acta Crystallogr D Biol Crystallogr ... Biochemistry 45, 6615–6627. 24 Raman J, Sumathy K, Anand RP & Balaram H (2004) A non-active site mutation in human hypoxanthine guanine phosphoribosyltransferase expands sub...

Ngày tải lên: 15/02/2014, 01:20

... coordinated by the carboxyl oxygen atoms of D8, D9, by the carboxamide oxygen of N92, by the hydroxyl oxygen of S39 and by the oxygen atoms of two water molecules, and has an approximate octahedral ... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the Nhe...

Ngày tải lên: 18/02/2014, 14:20

... Ureaplasma parvum UMP kinase – a potential antibacterial drug target Louise Egeblad-Welin 1 , Martin Welin 2, *, Liya Wang 1 and Staffan Eriksson 1 1 Department of Anatomy, Physiology and Biochemistry, ... determined, as observed by Fassy et al. [14], and avoids the complication of potential UTP formation. The coupling enzymes (pyruvate kinase and lactate dehydroge- nase) were t...

Ngày tải lên: 18/02/2014, 16:20

... logarithmic early stationary phase (days 3–5) and stationary phase (day 6). (A, B) The RNAs (20 lg per lane) were loaded onto agarose gel, separated by electrophoresis and transferred to a nylon ... disappearance was measured spectrophotometri- cally at 340 nm in a coupled enzyme assay to pyruvate kinase and lactate dehydrogenase at 30 °C. The assay mixture contained, in a total v...

Ngày tải lên: 21/02/2014, 00:20