Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx

Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx

Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx

... Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells Mi-Ock Lee 1, *, Hyo-Jin Kang 1, *, ... have not been elucidated. Nuclear factors of activated T-cells (NFAT) is a family of related transcription factors that play a c en...
Ngày tải lên : 24/03/2014, 03:21
  • 9
  • 481
  • 0
Báo cáo Y học: Molecular cloning, bacterial expression and properties of Rab31 and Rab32 docx

Báo cáo Y học: Molecular cloning, bacterial expression and properties of Rab31 and Rab32 docx

... GST±Rab32 Q85L relative to the unmutated proteins, suggesting that Rab31 and Rab32 fall into the same category as Rab1 1A and m ay not be constitutively activated by this mutation. These obser- vations emphasize the ... expression of Rab31 and Rab32 To generate an expression construct, Rab31 cDNA was ampli®ed from a platelet Marathon TM cDNA library, using as PCR primers, 5...
Ngày tải lên : 08/03/2014, 16:20
  • 13
  • 481
  • 0
Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"

Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"

... which included the frequency and type of emergency. The frequency of aircraft diversion was also investigated. All data regarding names, ages and the sex of the patient and the name of the air- line were anonymous. ... interests. Authors' contributions MS participated in the study design, data analysis and inter- pretation of the data as well as the writing o...
Ngày tải lên : 25/10/2012, 10:31
  • 6
  • 639
  • 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

... C13 2A: 5¢-CCGTT TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢. C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢.C-213S:5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢. C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢. ... H24 4A: 5¢-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3¢. D21 6A: 5¢-G CGAGCTTATATCTTTTGCAATGAAGATAAATCAT TTCCAGTTGAG-3¢ All of the primers were 5¢-p...
Ngày tải lên : 24/03/2014, 04:21
  • 8
  • 345
  • 0
Tài liệu Báo cáo Y học: DNA and RNA damage by Cu(II)-amikacin complex docx

Tài liệu Báo cáo Y học: DNA and RNA damage by Cu(II)-amikacin complex docx

... tRNA cleavage. Amikacin (Ami) is a semisynthetic aminoglycoside, a derivative of kanamycin A, having the B1 amino group of 2-deoxystreptamine moiety modified by acylation with 4-amino-2-hydroxybutyric ... than 75 min. Cleavage of yeast tRNA Phe induced by the Cu(II)-Ami-H 2 O 2 system Figure 6 shows the results of the strand-break assay of yeast tRNA Phe in the pre...
Ngày tải lên : 21/02/2014, 01:21
  • 10
  • 503
  • 1
Báo cáo Y học: Recombinant human glucose-6-phosphate dehydrogenase Evidence for a rapid-equilibrium random-order mechanism potx

Báo cáo Y học: Recombinant human glucose-6-phosphate dehydrogenase Evidence for a rapid-equilibrium random-order mechanism potx

... 2). Similarly, the values of / X and / XY // X / Y should remain unchanged regardless of the nature of substrate Y, even though there may be substantial changes to the individual values of / o , / Y and ... phosphate as the leading substrate can similarly be made by comparing the data for alternative coenzymes (Tables 1 and 2). The mean value of / NADP + Glc6P //...
Ngày tải lên : 08/03/2014, 22:20
  • 8
  • 373
  • 1
Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot

Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot

... ACCCGG GTCG ACTCAGTGATGGTGGTGATGGTGTCCTCGACC AAAAAGATC; rcpA:forward,GCGATA GAATTCATG AGCGTAGAAACGGAAGAC and reverse, CGAAGCTT GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG; cphB:forward,GCGATA GAATTC ATG ... phytochrome-like proteins of cyanobacteria (Calothrix sp. CphA and -B, Synechocystis sp. Cph1, and Anabaena sp. AphA and AphB, GenBank numbers AB028873 and AB034952), Arabidopsis thali...
Ngày tải lên : 08/03/2014, 23:20
  • 10
  • 499
  • 0
Báo cáo Y học: SMAP-29 has two LPS-binding sites and a central hinge docx

Báo cáo Y học: SMAP-29 has two LPS-binding sites and a central hinge docx

... 0.085%) trifluoroacetic acid. The molecular mass of the p roduct was confirmed by electrospray mass spectrometry, and its purity was confirmed by analytical HPLC a nd, in some cases, by capillary electrophoresis. Correspondence ... character from those of SMAP-29 or CAP-18. It a ppears therefore that the a helical antimicrobial peptides of mammalian leukocytes can vary c...
Ngày tải lên : 17/03/2014, 23:20
  • 9
  • 412
  • 0
Báo cáo khoa học: Neuroglobin and cytoglobin expression in mice Evidence for a correlation with reactive oxygen species scavenging doc

Báo cáo khoa học: Neuroglobin and cytoglobin expression in mice Evidence for a correlation with reactive oxygen species scavenging doc

... of increased hypoxia-inducible factor (HIF)- 1a and up- regulation of Cygb mRNA, and hypothesized that Cygb (and Ngb) may have a vital role in retinal oxy- gen homeostasis, enabling the retina ... severity of hypoxia. The mechanism of induction of Cygb is regu- lated by HIF-1. The aim of this study was to illustrate the time dependency and the tissue specificity o...
Ngày tải lên : 23/03/2014, 09:21
  • 6
  • 391
  • 0
Báo cáo khoa học: Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure pdf

Báo cáo khoa học: Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure pdf

... 10, 519–533. 22 Takahashi Y, Shirono H, Arisaka O, Takahashi K, Yagi T, Koga J, Kaji H, Okimura Y, Abe H, Tanaka T & Chihara K (1997) Biologically inactive growth hor- mone caused by an amino acid substitution. ... activation of signal transducer and activator of transcription-3 (STAT3). Impaired STAT3 activation was accompanied by cell-cycle arrest at the G o ⁄ G 1 phase. I...
Ngày tải lên : 23/03/2014, 10:21
  • 13
  • 323
  • 0

Xem thêm